Mutagenetix > Incidental Mutations

Incidental Mutation 'R2067:Trpm7'

226731

Institutional Source

Beutler Lab

Gene Symbol

Trpm7

Ensembl Gene

ENSMUSG00000027365

Gene Name

transient receptor potential cation channel, subfamily M, member 7

Synonyms

LTRPC7, 2310022G15Rik, CHAK, CHAK1, Ltpr7, 4833414K03Rik, 5033407O22Rik, TRP-PLIK

MMRRC Submission

040072-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2067 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

126791565-126876230 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 126797727 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 1650 (P1650S)

Ref Sequence

ENSEMBL: ENSMUSP00000099513 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028843] [ENSMUST00000103224]

AlphaFold

Q923J1

PDB Structure

CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (AMPPNP COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (ADP-MG COMPLEX) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ATYPICAL PROTEIN KINASE DOMAIN OF A TRP CA-CHANNEL, CHAK (APO) [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000028843
AA Change: P1649S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000028843
Gene: ENSMUSG00000027365
AA Change: P1649S

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
Pfam:Ion_trans	887	1096	3e-8	PFAM
PDB:3E7K\|H	1198	1249	6e-27	PDB
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1545	6e-64	BLAST
Alpha_kinase	1596	1813	3.77e-89	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000103224
AA Change: P1650S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099513
Gene: ENSMUSG00000027365
AA Change: P1650S

Domain	Start	End	E-Value	Type
Blast:ANK	438	467	5e-6	BLAST
low complexity region	541	555	N/A	INTRINSIC
transmembrane domain	757	774	N/A	INTRINSIC
Pfam:Ion_trans	855	1108	1.7e-9	PFAM
Pfam:TRPM_tetra	1194	1249	3.3e-29	PFAM
low complexity region	1385	1397	N/A	INTRINSIC
Blast:Alpha_kinase	1398	1546	2e-64	BLAST
Alpha_kinase	1597	1814	3.77e-89	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125327

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127277

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135733

Predicted Effect

unknown
Transcript: ENSMUST00000136964
AA Change: P40S

SMART Domains

Protein: ENSMUSP00000119232
Gene: ENSMUSG00000027365
AA Change: P40S

Domain	Start	End	E-Value	Type
Alpha_kinase	1	242	8e-61	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155675

Meta Mutation Damage Score

0.4834

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is both an ion channel and a serine/threonine protein kinase. The kinase activity is essential for the ion channel function, which serves to increase intracellular calcium levels and to help regulate magnesium ion homeostasis. Defects in this gene are a cause of amyotrophic lateral sclerosis-parkinsonism/dementia complex of Guam. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele display embryonic lehality. Mice with conditional deletion in developing thymocytes display a block in thymopoiesis. Mice homozygous for a kinase deleted allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit altered magnesium homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	T	A	4: 122,689,322		probably benign	Het
Abca2	A	T	2: 25,437,505	I669F	possibly damaging	Het
Acin1	T	A	14: 54,665,254	Q360H	probably damaging	Het
Aldh3b1	T	A	19: 3,921,755	D72V	probably benign	Het
Alox12e	G	A	11: 70,316,002	R620W	probably damaging	Het
Alpl	T	C	4: 137,749,545		probably benign	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ascc2	A	T	11: 4,681,496	M646L	probably benign	Het
Bod1l	G	A	5: 41,817,086	T2295M	probably benign	Het
Ccdc9	A	T	7: 16,278,550		probably null	Het
Clptm1l	C	T	13: 73,607,723	Q153*	probably null	Het
Csmd1	A	G	8: 15,900,782	S3476P	probably benign	Het
Ddias	A	T	7: 92,859,699	M336K	possibly damaging	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Epha1	G	T	6: 42,366,053	H187Q	probably benign	Het
Espl1	T	C	15: 102,299,090	S330P	probably damaging	Het
Fbln7	G	T	2: 128,877,466	R61L	probably damaging	Het
Fbxo41	C	T	6: 85,478,471	W577*	probably null	Het
Fgb	C	A	3: 83,049,689	D25Y	probably benign	Het
Gc	T	A	5: 89,446,517	K37N	probably damaging	Het
Gfpt1	T	C	6: 87,057,754	I178T	probably benign	Het
Gm12695	T	C	4: 96,769,726	T69A	probably benign	Het
Gm3944	C	A	12: 18,853,894	S8*	probably null	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Gpr156	A	G	16: 37,978,751	D109G	probably benign	Het
Hoxd1	A	T	2: 74,763,366	T89S	probably benign	Het
Htt	C	T	5: 34,825,982	T975I	probably benign	Het
Itpr3	G	A	17: 27,098,076	M768I	probably benign	Het
Krt4	C	A	15: 101,924,664	A3S	possibly damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Mup4	T	A	4: 59,960,622		probably benign	Het
Myh1	G	A	11: 67,214,620	D1079N	possibly damaging	Het
Myo1a	A	G	10: 127,705,478	N43D	probably benign	Het
Napa	A	T	7: 16,115,278		probably benign	Het
Ndufa12	A	G	10: 94,220,707	D99G	probably damaging	Het
Neb	A	G	2: 52,284,263	I1528T	probably benign	Het
Nek1	T	C	8: 61,007,162	S41P	probably damaging	Het
Nolc1	C	T	19: 46,083,607	T612M	probably damaging	Het
Nsun5	T	G	5: 135,375,072	Y301D	probably damaging	Het
Oas1g	T	C	5: 120,885,883	E121G	probably damaging	Het
Olfr1085	G	T	2: 86,658,437	T7K	probably damaging	Het
Olfr1170	A	G	2: 88,224,474	V186A	possibly damaging	Het
Olfr324	A	G	11: 58,597,570	N58S	probably damaging	Het
Olfr397	A	G	11: 73,964,914	Y102C	probably damaging	Het
Olfr522	T	A	7: 140,162,909	I14F	possibly damaging	Het
Olfr910	T	A	9: 38,539,280	N128K	probably benign	Het
Osmr	T	C	15: 6,815,415	N957D	probably benign	Het
Parn	G	A	16: 13,603,069	S473L	probably damaging	Het
Phc2	T	C	4: 128,747,136	F672S	probably damaging	Het
Pik3c2b	T	C	1: 133,099,611	S1283P	probably damaging	Het
Pole2	G	A	12: 69,228,152	R5W	probably benign	Het
Prl7a2	T	A	13: 27,660,887	Y172F	probably damaging	Het
Ptprz1	A	G	6: 23,050,389		probably benign	Het
Rapgef3	C	A	15: 97,766,961	G7V	probably damaging	Het
Ripor1	T	A	8: 105,617,708	S491R	probably benign	Het
Rnf141	A	G	7: 110,821,365		probably benign	Het
Ryr3	C	T	2: 112,946,957	R285Q	probably damaging	Het
Sall4	T	C	2: 168,756,545	N125S	probably benign	Het
Schip1	A	G	3: 68,617,786	K360R	probably damaging	Het
Senp6	T	A	9: 80,089,869	V55E	probably benign	Het
Skint1	T	A	4: 112,025,533	V258D	probably benign	Het
Slc25a16	T	A	10: 62,932,751	H130Q	probably benign	Het
Styx	T	C	14: 45,373,563	V217A	probably benign	Het
Syne2	G	A	12: 75,888,342		probably null	Het
Tagap1	A	G	17: 6,956,860	S146P	probably benign	Het
Tatdn2	A	G	6: 113,704,142	K379E	probably benign	Het
Thrap3	T	C	4: 126,175,396	Y654C	possibly damaging	Het
Tle2	T	C	10: 81,580,551	L135P	probably damaging	Het
Tmc1	A	G	19: 20,824,309	F451S	possibly damaging	Het
Ttll4	G	A	1: 74,680,382	R16H	possibly damaging	Het
Ttn	T	C	2: 76,714,373	N32795S	probably damaging	Het
Tubgcp6	T	C	15: 89,104,489	E803G	probably benign	Het
Ubr2	A	G	17: 46,963,145		probably null	Het
Ugt2b35	A	G	5: 87,001,553	D221G	probably damaging	Het
Unc45b	G	A	11: 82,911,689	A4T	probably benign	Het
Vmn1r70	A	T	7: 10,634,337	I251F	possibly damaging	Het
Vmn2r120	T	A	17: 57,524,553	H412L	possibly damaging	Het
Zfp59	A	G	7: 27,853,510	N129S	probably benign	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Trpm7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Trpm7	APN	2	126829031	missense	possibly damaging	0.82
IGL01084:Trpm7	APN	2	126846072	critical splice donor site	probably null
IGL01634:Trpm7	APN	2	126826818	missense	probably damaging	1.00
IGL01678:Trpm7	APN	2	126816799	missense	probably damaging	0.99
IGL02005:Trpm7	APN	2	126813184	missense	probably damaging	0.97
IGL02064:Trpm7	APN	2	126797943	missense	probably damaging	1.00
IGL02156:Trpm7	APN	2	126799243	unclassified	probably benign
IGL02172:Trpm7	APN	2	126795328	missense	possibly damaging	0.94
IGL02334:Trpm7	APN	2	126807362	missense	probably benign
IGL02375:Trpm7	APN	2	126825744	missense	probably damaging	1.00
IGL02388:Trpm7	APN	2	126819891	missense	possibly damaging	0.80
IGL02552:Trpm7	APN	2	126840779	missense	probably damaging	1.00
IGL02684:Trpm7	APN	2	126846159	missense	probably damaging	0.99
IGL02901:Trpm7	APN	2	126807287	critical splice donor site	probably null
Accused	UTSW	2	126826737	missense	probably damaging	0.99
Condemned	UTSW	2	126835508	missense	probably damaging	1.00
denounced	UTSW	2	126813021	missense	probably benign	0.00
deposed	UTSW	2	126797498	missense	probably benign	0.01
Summac	UTSW	2	126819963	missense	probably damaging	1.00
Vacated	UTSW	2	126849922	missense	probably damaging	1.00
P0037:Trpm7	UTSW	2	126816757	splice site	probably benign
R0038:Trpm7	UTSW	2	126795468	missense	probably damaging	1.00
R0139:Trpm7	UTSW	2	126812771	missense	probably benign
R0165:Trpm7	UTSW	2	126797513	missense	probably damaging	0.97
R0511:Trpm7	UTSW	2	126826718	nonsense	probably null
R0543:Trpm7	UTSW	2	126848529	missense	probably damaging	1.00
R0784:Trpm7	UTSW	2	126846072	critical splice donor site	probably null
R0844:Trpm7	UTSW	2	126835508	missense	probably damaging	1.00
R0865:Trpm7	UTSW	2	126799239	splice site	probably null
R0919:Trpm7	UTSW	2	126831238	missense	probably damaging	1.00
R0972:Trpm7	UTSW	2	126805049	missense	probably benign
R1109:Trpm7	UTSW	2	126797793	missense	probably benign	0.01
R1118:Trpm7	UTSW	2	126822486	missense	possibly damaging	0.63
R1278:Trpm7	UTSW	2	126825454	nonsense	probably null
R1527:Trpm7	UTSW	2	126830162	missense	probably benign	0.18
R1542:Trpm7	UTSW	2	126822599	nonsense	probably null
R1882:Trpm7	UTSW	2	126812777	missense	probably benign	0.00
R1951:Trpm7	UTSW	2	126831299	missense	probably damaging	1.00
R2011:Trpm7	UTSW	2	126823997	nonsense	probably null
R2012:Trpm7	UTSW	2	126823997	nonsense	probably null
R2026:Trpm7	UTSW	2	126812738	missense	probably benign	0.39
R2926:Trpm7	UTSW	2	126858409	splice site	probably benign
R3082:Trpm7	UTSW	2	126844422	missense	possibly damaging	0.90
R3552:Trpm7	UTSW	2	126826710	splice site	probably benign
R3607:Trpm7	UTSW	2	126796428	intron	probably benign
R3739:Trpm7	UTSW	2	126851521	missense	probably damaging	1.00
R3943:Trpm7	UTSW	2	126831218	missense	possibly damaging	0.94
R4161:Trpm7	UTSW	2	126816831	missense	probably damaging	1.00
R4176:Trpm7	UTSW	2	126829163	missense	possibly damaging	0.83
R4392:Trpm7	UTSW	2	126795509	splice site	probably null
R4392:Trpm7	UTSW	2	126848538	missense	probably damaging	1.00
R4404:Trpm7	UTSW	2	126833715	missense	probably damaging	0.97
R4574:Trpm7	UTSW	2	126797211	missense	probably benign	0.01
R4714:Trpm7	UTSW	2	126840783	nonsense	probably null
R4807:Trpm7	UTSW	2	126831229	missense	probably benign	0.00
R4815:Trpm7	UTSW	2	126858492	missense	probably damaging	1.00
R4846:Trpm7	UTSW	2	126813185	missense	possibly damaging	0.63
R4972:Trpm7	UTSW	2	126824058	missense	probably damaging	1.00
R5097:Trpm7	UTSW	2	126796336	critical splice donor site	probably null
R5263:Trpm7	UTSW	2	126821217	missense	probably benign	0.34
R5361:Trpm7	UTSW	2	126829241	missense	possibly damaging	0.77
R5377:Trpm7	UTSW	2	126842855	critical splice donor site	probably null
R5574:Trpm7	UTSW	2	126813030	missense	probably benign
R5782:Trpm7	UTSW	2	126797714	missense	probably benign	0.04
R5840:Trpm7	UTSW	2	126822611	nonsense	probably null
R6044:Trpm7	UTSW	2	126814745	missense	probably damaging	1.00
R6178:Trpm7	UTSW	2	126837381	missense	probably damaging	1.00
R6196:Trpm7	UTSW	2	126825639	missense	possibly damaging	0.66
R6457:Trpm7	UTSW	2	126807294	missense	probably benign
R6530:Trpm7	UTSW	2	126812711	missense	probably damaging	1.00
R6764:Trpm7	UTSW	2	126844420	missense	possibly damaging	0.79
R6841:Trpm7	UTSW	2	126813021	missense	probably benign	0.00
R6868:Trpm7	UTSW	2	126837414	missense	probably damaging	1.00
R7250:Trpm7	UTSW	2	126826765	missense	possibly damaging	0.87
R7402:Trpm7	UTSW	2	126799206	missense	probably damaging	1.00
R7451:Trpm7	UTSW	2	126826737	missense	probably damaging	0.99
R7486:Trpm7	UTSW	2	126831195	critical splice donor site	probably null
R7509:Trpm7	UTSW	2	126849922	missense	probably damaging	1.00
R7586:Trpm7	UTSW	2	126810165	missense	probably benign
R7774:Trpm7	UTSW	2	126813238	missense	probably benign	0.09
R7793:Trpm7	UTSW	2	126824075	nonsense	probably null
R7812:Trpm7	UTSW	2	126799316	missense	probably damaging	1.00
R7900:Trpm7	UTSW	2	126797498	missense	probably benign	0.01
R7951:Trpm7	UTSW	2	126813268	missense	possibly damaging	0.94
R7965:Trpm7	UTSW	2	126825694	missense	probably damaging	0.99
R7992:Trpm7	UTSW	2	126825534	missense	probably benign
R8034:Trpm7	UTSW	2	126846199	missense	probably damaging	0.98
R8199:Trpm7	UTSW	2	126849998	missense	probably damaging	1.00
R8304:Trpm7	UTSW	2	126797877	missense	probably damaging	1.00
R8405:Trpm7	UTSW	2	126816835	missense	probably benign	0.26
R8674:Trpm7	UTSW	2	126799166	unclassified	probably benign
R8742:Trpm7	UTSW	2	126825549	missense	probably damaging	1.00
R8754:Trpm7	UTSW	2	126822703	missense	probably damaging	1.00
R8842:Trpm7	UTSW	2	126821211	missense	probably benign	0.05
R8850:Trpm7	UTSW	2	126810180	missense	probably benign	0.00
R8881:Trpm7	UTSW	2	126819963	missense	probably damaging	1.00
R8898:Trpm7	UTSW	2	126822741	missense	possibly damaging	0.92
R9339:Trpm7	UTSW	2	126823986	missense	probably benign	0.04
R9428:Trpm7	UTSW	2	126829220	missense	probably damaging	1.00
X0026:Trpm7	UTSW	2	126829290	missense	probably benign
Z1088:Trpm7	UTSW	2	126797281	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGAAGGGCCTTATCAATATG -3'
(R):5'- TCATTTGTGTTACAGGCGAGCC -3'

Sequencing Primer
(F):5'- AGGGCCTTATCAATATGTAAGATTTC -3'
(R):5'- TCACAGTGTACCGTCTGGAG -3'

Posted On

2014-09-17