Incidental Mutation 'R0148:Flnb'
ID22674
Institutional Source Beutler Lab
Gene Symbol Flnb
Ensembl Gene ENSMUSG00000025278
Gene Namefilamin, beta
Synonyms
MMRRC Submission 038432-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0148 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location7817957-7951588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7939077 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 2307 (S2307P)
Ref Sequence ENSEMBL: ENSMUSP00000052020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052678]
Predicted Effect probably benign
Transcript: ENSMUST00000052678
AA Change: S2307P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000052020
Gene: ENSMUSG00000025278
AA Change: S2307P

DomainStartEndE-ValueType
CH 18 120 2.38e-26 SMART
CH 141 237 1.83e-18 SMART
IG_FLMN 253 350 1.17e-33 SMART
IG_FLMN 353 449 2.08e-34 SMART
IG_FLMN 451 546 3.42e-35 SMART
IG_FLMN 548 639 6.06e-27 SMART
IG_FLMN 644 739 1.94e-34 SMART
IG_FLMN 741 842 4.25e-31 SMART
IG_FLMN 844 941 5.16e-30 SMART
IG_FLMN 943 1037 5.12e-25 SMART
IG_FLMN 1039 1130 5.31e-41 SMART
IG_FLMN 1132 1225 1.4e-31 SMART
IG_FLMN 1227 1325 1.42e-32 SMART
IG_FLMN 1327 1418 5.19e-35 SMART
IG_FLMN 1420 1514 2.48e-41 SMART
IG_FLMN 1516 1611 3.15e-34 SMART
IG_FLMN 1613 1707 4.99e-37 SMART
IG_FLMN 1730 1819 4.44e-11 SMART
IG_FLMN 1820 1911 5.82e-38 SMART
IG_FLMN 1914 1997 5.68e-9 SMART
IG_FLMN 2001 2092 4.45e-34 SMART
IG_FLMN 2101 2188 1.24e-9 SMART
IG_FLMN 2192 2283 4.48e-39 SMART
IG_FLMN 2286 2378 2.94e-25 SMART
IG_FLMN 2383 2474 5.66e-27 SMART
IG_FLMN 2511 2602 1.63e-27 SMART
Meta Mutation Damage Score 0.5051 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 86% (30/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the filamin family. The encoded protein interacts with glycoprotein Ib alpha as part of the process to repair vascular injuries. The platelet glycoprotein Ib complex includes glycoprotein Ib alpha, and it binds the actin cytoskeleton. Mutations in this gene have been found in several conditions: atelosteogenesis type 1 and type 3; boomerang dysplasia; autosomal dominant Larsen syndrome; and spondylocarpotarsal synostosis syndrome. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mutations in this gene cause skeletal defects including runting, premature mineralization, and bone fusion. Nullizygous mice show a delay and reduction in long bone growth. Truncation mutations cause early fusion of spinal vertebrae due to enhanced chondrocyte hypertrophy and early differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,662,446 probably null Het
Agtr1a T C 13: 30,381,944 S331P probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Bahcc1 A T 11: 120,268,404 Q152H probably damaging Het
Bend3 T A 10: 43,511,950 Y780N probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Efl1 T C 7: 82,671,670 S104P probably damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fbln1 G A 15: 85,230,826 R193H probably damaging Het
Fbxw21 A G 9: 109,148,017 probably null Het
Fgf17 C T 14: 70,638,873 R49Q probably damaging Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Git1 A G 11: 77,505,728 T601A probably benign Het
Gm10722 T "C,A" 9: 3,001,405 probably null Het
Gm5142 C T 14: 59,178,670 R13H possibly damaging Het
Gria2 A C 3: 80,707,731 W481G probably damaging Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Il4ra T A 7: 125,575,537 C306S probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Lama3 G A 18: 12,448,272 C596Y probably damaging Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
March6 C T 15: 31,490,612 V293M probably damaging Het
Med12l A G 3: 59,037,654 D100G probably damaging Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mrpl53 T C 6: 83,109,537 L74P probably damaging Het
Mvp C T 7: 126,989,865 V577M probably damaging Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nipsnap3b C T 4: 53,017,088 A104V possibly damaging Het
Nlrp14 A G 7: 107,182,721 Y375C probably benign Het
Nod1 A G 6: 54,938,217 Y764H probably damaging Het
Olfr225 G A 11: 59,613,494 V177M probably damaging Het
Olfr270 A T 4: 52,971,232 I204F probably benign Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Peg10 C A 6: 4,755,711 R96S possibly damaging Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rilp A T 11: 75,510,233 H29L probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Ryr1 C A 7: 29,052,035 R3706L probably damaging Het
Ryr2 T C 13: 11,714,548 D2396G probably damaging Het
Slc45a2 T C 15: 11,025,868 S435P probably damaging Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tep1 A T 14: 50,824,789 D2535E possibly damaging Het
Tkt T A 14: 30,572,220 I529N probably damaging Het
Trp53i11 T G 2: 93,197,735 V39G probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Usp3 A G 9: 66,540,167 V219A possibly damaging Het
Usp4 T A 9: 108,391,671 probably null Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Xkr6 T C 14: 63,819,549 V303A unknown Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfhx2 A G 14: 55,072,897 Y731H possibly damaging Het
Other mutations in Flnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Flnb APN 14 7917390 splice site probably benign
IGL01063:Flnb APN 14 7926518 splice site probably benign
IGL01135:Flnb APN 14 7909736 missense probably benign
IGL01139:Flnb APN 14 7945989 missense probably damaging 1.00
IGL01364:Flnb APN 14 7934562 critical splice acceptor site probably null
IGL01417:Flnb APN 14 7905513 missense probably damaging 0.99
IGL01505:Flnb APN 14 7902003 critical splice donor site probably null
IGL01560:Flnb APN 14 7893829 missense probably benign 0.07
IGL01621:Flnb APN 14 7950470 missense probably damaging 1.00
IGL01656:Flnb APN 14 7902010 splice site probably benign
IGL01889:Flnb APN 14 7935967 missense possibly damaging 0.85
IGL01987:Flnb APN 14 7922748 critical splice donor site probably null
IGL02322:Flnb APN 14 7894676 missense probably damaging 1.00
IGL02496:Flnb APN 14 7930919 splice site probably benign
IGL02752:Flnb APN 14 7917338 missense probably benign
IGL03001:Flnb APN 14 7934680 missense probably damaging 0.99
IGL03076:Flnb APN 14 7901988 missense probably benign 0.01
IGL03085:Flnb APN 14 7882211 missense probably benign
IGL03170:Flnb APN 14 7818261 missense possibly damaging 0.90
IGL03373:Flnb APN 14 7890867 critical splice donor site probably null
Boomerang UTSW 14 7901945 missense probably damaging 1.00
Queensland UTSW 14 7927352 missense probably damaging 1.00
R3437_Flnb_252 UTSW 14 7942057 missense probably damaging 0.97
R8441_Flnb_221 UTSW 14 7896488 missense probably benign 0.15
Rhodelinda UTSW 14 7887682 splice site probably benign
saul UTSW 14 7889183 missense probably damaging 0.99
Xerxes UTSW 14 7867551 missense probably damaging 1.00
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0068:Flnb UTSW 14 7915290 missense possibly damaging 0.49
R0084:Flnb UTSW 14 7935979 missense probably benign
R0128:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0130:Flnb UTSW 14 7901951 missense probably damaging 0.99
R0166:Flnb UTSW 14 7896115 missense probably damaging 1.00
R0376:Flnb UTSW 14 7946014 critical splice donor site probably null
R0547:Flnb UTSW 14 7912943 splice site probably null
R0612:Flnb UTSW 14 7887682 splice site probably benign
R0656:Flnb UTSW 14 7927352 missense probably damaging 1.00
R0691:Flnb UTSW 14 7890810 missense probably benign 0.16
R1241:Flnb UTSW 14 7896503 missense probably benign 0.06
R1572:Flnb UTSW 14 7883908 missense probably damaging 0.97
R1682:Flnb UTSW 14 7913121 missense probably benign 0.04
R1807:Flnb UTSW 14 7934645 missense probably benign 0.26
R1848:Flnb UTSW 14 7892113 missense probably damaging 1.00
R1959:Flnb UTSW 14 7884735 nonsense probably null
R2078:Flnb UTSW 14 7927466 missense probably damaging 1.00
R2132:Flnb UTSW 14 7873376 missense probably benign 0.04
R2209:Flnb UTSW 14 7905507 nonsense probably null
R2212:Flnb UTSW 14 7881652 small deletion probably benign
R2213:Flnb UTSW 14 7881652 small deletion probably benign
R2363:Flnb UTSW 14 7945950 missense possibly damaging 0.95
R2415:Flnb UTSW 14 7929932 missense probably benign 0.07
R2983:Flnb UTSW 14 7882250 missense probably damaging 1.00
R3001:Flnb UTSW 14 7907162 missense probably benign 0.22
R3002:Flnb UTSW 14 7907162 missense probably benign 0.22
R3436:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3437:Flnb UTSW 14 7942057 missense probably damaging 0.97
R3778:Flnb UTSW 14 7915353 missense probably benign 0.06
R3783:Flnb UTSW 14 7889236 missense probably benign 0.04
R4162:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4163:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4164:Flnb UTSW 14 7915374 missense possibly damaging 0.81
R4356:Flnb UTSW 14 7922700 missense probably benign
R4369:Flnb UTSW 14 7942216 missense probably benign
R4783:Flnb UTSW 14 7905701 missense probably benign 0.12
R4785:Flnb UTSW 14 7905701 missense probably benign 0.12
R4790:Flnb UTSW 14 7905661 missense probably benign 0.34
R4828:Flnb UTSW 14 7919238 missense probably benign 0.13
R4882:Flnb UTSW 14 7929936 missense possibly damaging 0.56
R5002:Flnb UTSW 14 7945882 missense probably damaging 1.00
R5058:Flnb UTSW 14 7924262 nonsense probably null
R5184:Flnb UTSW 14 7901945 missense probably damaging 1.00
R5186:Flnb UTSW 14 7909748 missense probably damaging 1.00
R5395:Flnb UTSW 14 7883881 missense probably benign 0.02
R5421:Flnb UTSW 14 7926494 missense probably damaging 1.00
R5667:Flnb UTSW 14 7890843 missense probably benign 0.00
R5671:Flnb UTSW 14 7890843 missense probably benign 0.00
R5714:Flnb UTSW 14 7929073 missense probably damaging 1.00
R5860:Flnb UTSW 14 7931135 missense probably damaging 1.00
R5892:Flnb UTSW 14 7907183 missense probably damaging 1.00
R5924:Flnb UTSW 14 7890765 missense probably benign 0.00
R6131:Flnb UTSW 14 7894635 missense possibly damaging 0.79
R6244:Flnb UTSW 14 7892092 missense probably damaging 1.00
R6489:Flnb UTSW 14 7867551 missense probably damaging 1.00
R6582:Flnb UTSW 14 7892275 critical splice donor site probably null
R6586:Flnb UTSW 14 7929138 missense possibly damaging 0.93
R6611:Flnb UTSW 14 7915318 missense probably damaging 1.00
R6626:Flnb UTSW 14 7929012 missense probably damaging 1.00
R6700:Flnb UTSW 14 7892189 missense probably damaging 0.99
R6738:Flnb UTSW 14 7904536 missense probably benign 0.01
R6864:Flnb UTSW 14 7905640 missense possibly damaging 0.84
R6916:Flnb UTSW 14 7907171 missense probably damaging 0.99
R7117:Flnb UTSW 14 7894214 missense probably benign 0.02
R7164:Flnb UTSW 14 7915944 splice site probably null
R7328:Flnb UTSW 14 7883788 missense possibly damaging 0.95
R7328:Flnb UTSW 14 7894660 nonsense probably null
R7687:Flnb UTSW 14 7924224 missense probably damaging 1.00
R7716:Flnb UTSW 14 7917274 missense possibly damaging 0.64
R7763:Flnb UTSW 14 7926478 missense probably benign 0.00
R7821:Flnb UTSW 14 7939113 missense probably benign 0.00
R7921:Flnb UTSW 14 7933800 missense possibly damaging 0.57
R8008:Flnb UTSW 14 7892155 missense probably damaging 1.00
R8075:Flnb UTSW 14 7913048 missense probably benign 0.00
R8084:Flnb UTSW 14 7907243 missense probably benign 0.00
R8259:Flnb UTSW 14 7889183 missense probably damaging 0.99
R8441:Flnb UTSW 14 7896488 missense probably benign 0.15
R8493:Flnb UTSW 14 7869822 missense probably damaging 0.97
R8508:Flnb UTSW 14 7950394 missense probably damaging 0.98
R8531:Flnb UTSW 14 7929939 missense probably damaging 1.00
R8812:Flnb UTSW 14 7887624 missense probably benign 0.06
R8814:Flnb UTSW 14 7927409 missense probably damaging 1.00
R8825:Flnb UTSW 14 7887566 missense probably damaging 1.00
R8868:Flnb UTSW 14 7908671 missense probably benign 0.02
R8955:Flnb UTSW 14 7892874 missense probably damaging 1.00
R8955:Flnb UTSW 14 7904688 nonsense probably null
X0066:Flnb UTSW 14 7908636 missense probably damaging 1.00
Z1088:Flnb UTSW 14 7905871 missense probably benign 0.04
Z1176:Flnb UTSW 14 7942066 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CTGCCCCGTCTTGTTATCAGGTATG -3'
(R):5'- GGGTATTGCTGTCACACAGAGAGTC -3'

Sequencing Primer
(F):5'- GTCTTGTTATCAGGTATGACAGATG -3'
(R):5'- CCCATTTTAGAAACGATGCCTGG -3'
Posted On2013-04-16