Incidental Mutation 'R2067:Htt'
ID 226750
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Name huntingtin
Synonyms Hdh, huntingtin, HD, IT15, htt, C430023I11Rik
MMRRC Submission 040072-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2067 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 34919084-35069878 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34983326 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 975 (T975I)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000080036
AA Change: T975I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: T975I

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148953
Meta Mutation Damage Score 0.1011 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,583,115 (GRCm39) probably benign Het
Abca2 A T 2: 25,327,517 (GRCm39) I669F possibly damaging Het
Acin1 T A 14: 54,902,711 (GRCm39) Q360H probably damaging Het
Aldh3b1 T A 19: 3,971,755 (GRCm39) D72V probably benign Het
Alox12e G A 11: 70,206,828 (GRCm39) R620W probably damaging Het
Alpl T C 4: 137,476,856 (GRCm39) probably benign Het
Amy2a1 T C 3: 113,324,217 (GRCm39) I108V probably benign Het
Ascc2 A T 11: 4,631,496 (GRCm39) M646L probably benign Het
Bod1l G A 5: 41,974,429 (GRCm39) T2295M probably benign Het
Ccdc9 A T 7: 16,012,475 (GRCm39) probably null Het
Clptm1l C T 13: 73,755,842 (GRCm39) Q153* probably null Het
Csmd1 A G 8: 15,950,782 (GRCm39) S3476P probably benign Het
Ddias A T 7: 92,508,907 (GRCm39) M336K possibly damaging Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Epha1 G T 6: 42,342,987 (GRCm39) H187Q probably benign Het
Espl1 T C 15: 102,207,525 (GRCm39) S330P probably damaging Het
Fbln7 G T 2: 128,719,386 (GRCm39) R61L probably damaging Het
Fbxo41 C T 6: 85,455,453 (GRCm39) W577* probably null Het
Fgb C A 3: 82,956,996 (GRCm39) D25Y probably benign Het
Gc T A 5: 89,594,376 (GRCm39) K37N probably damaging Het
Gfpt1 T C 6: 87,034,736 (GRCm39) I178T probably benign Het
Gm12695 T C 4: 96,657,963 (GRCm39) T69A probably benign Het
Gm3944 C A 12: 18,903,895 (GRCm39) S8* probably null Het
Gm9912 T C 3: 148,890,795 (GRCm39) T113A unknown Het
Gpr156 A G 16: 37,799,113 (GRCm39) D109G probably benign Het
Hoxd1 A T 2: 74,593,710 (GRCm39) T89S probably benign Het
Itpr3 G A 17: 27,317,050 (GRCm39) M768I probably benign Het
Krt4 C A 15: 101,833,099 (GRCm39) A3S possibly damaging Het
Mrto4 T C 4: 139,076,334 (GRCm39) K86E probably benign Het
Mup4 T A 4: 59,960,622 (GRCm39) probably benign Het
Myh1 G A 11: 67,105,446 (GRCm39) D1079N possibly damaging Het
Myo1a A G 10: 127,541,347 (GRCm39) N43D probably benign Het
Napa A T 7: 15,849,203 (GRCm39) probably benign Het
Ndufa12 A G 10: 94,056,569 (GRCm39) D99G probably damaging Het
Neb A G 2: 52,174,275 (GRCm39) I1528T probably benign Het
Nek1 T C 8: 61,460,196 (GRCm39) S41P probably damaging Het
Nolc1 C T 19: 46,072,046 (GRCm39) T612M probably damaging Het
Nsun5 T G 5: 135,403,926 (GRCm39) Y301D probably damaging Het
Oas1g T C 5: 121,023,946 (GRCm39) E121G probably damaging Het
Or1e1f A G 11: 73,855,740 (GRCm39) Y102C probably damaging Het
Or2ab1 A G 11: 58,488,396 (GRCm39) N58S probably damaging Het
Or5d41 A G 2: 88,054,818 (GRCm39) V186A possibly damaging Het
Or6ae1 T A 7: 139,742,822 (GRCm39) I14F possibly damaging Het
Or8b46 T A 9: 38,450,576 (GRCm39) N128K probably benign Het
Or8k38 G T 2: 86,488,781 (GRCm39) T7K probably damaging Het
Osmr T C 15: 6,844,896 (GRCm39) N957D probably benign Het
Parn G A 16: 13,420,933 (GRCm39) S473L probably damaging Het
Phc2 T C 4: 128,640,929 (GRCm39) F672S probably damaging Het
Pik3c2b T C 1: 133,027,349 (GRCm39) S1283P probably damaging Het
Pole2 G A 12: 69,274,926 (GRCm39) R5W probably benign Het
Prl7a2 T A 13: 27,844,870 (GRCm39) Y172F probably damaging Het
Ptprz1 A G 6: 23,050,388 (GRCm39) probably benign Het
Rapgef3 C A 15: 97,664,842 (GRCm39) G7V probably damaging Het
Ripor1 T A 8: 106,344,340 (GRCm39) S491R probably benign Het
Rnf141 A G 7: 110,420,572 (GRCm39) probably benign Het
Ryr3 C T 2: 112,777,302 (GRCm39) R285Q probably damaging Het
Sall4 T C 2: 168,598,465 (GRCm39) N125S probably benign Het
Schip1 A G 3: 68,525,119 (GRCm39) K360R probably damaging Het
Senp6 T A 9: 79,997,151 (GRCm39) V55E probably benign Het
Skint1 T A 4: 111,882,730 (GRCm39) V258D probably benign Het
Slc25a16 T A 10: 62,768,530 (GRCm39) H130Q probably benign Het
Styx T C 14: 45,611,020 (GRCm39) V217A probably benign Het
Syne2 G A 12: 75,935,116 (GRCm39) probably null Het
Tagap1 A G 17: 7,224,259 (GRCm39) S146P probably benign Het
Tatdn2 A G 6: 113,681,103 (GRCm39) K379E probably benign Het
Thrap3 T C 4: 126,069,189 (GRCm39) Y654C possibly damaging Het
Tle2 T C 10: 81,416,385 (GRCm39) L135P probably damaging Het
Tmc1 A G 19: 20,801,673 (GRCm39) F451S possibly damaging Het
Trpm7 G A 2: 126,639,647 (GRCm39) P1650S probably damaging Het
Ttll4 G A 1: 74,719,541 (GRCm39) R16H possibly damaging Het
Ttn T C 2: 76,544,717 (GRCm39) N32795S probably damaging Het
Tubgcp6 T C 15: 88,988,692 (GRCm39) E803G probably benign Het
Ubr2 A G 17: 47,274,071 (GRCm39) probably null Het
Ugt2b35 A G 5: 87,149,412 (GRCm39) D221G probably damaging Het
Unc45b G A 11: 82,802,515 (GRCm39) A4T probably benign Het
Vmn1r70 A T 7: 10,368,264 (GRCm39) I251F possibly damaging Het
Vmn2r120 T A 17: 57,831,553 (GRCm39) H412L possibly damaging Het
Zfp59 A G 7: 27,552,935 (GRCm39) N129S probably benign Het
Zgrf1 T C 3: 127,406,999 (GRCm39) C1589R probably damaging Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34,956,752 (GRCm39) missense probably benign 0.00
IGL00233:Htt APN 5 35,053,370 (GRCm39) splice site probably null
IGL00559:Htt APN 5 35,006,448 (GRCm39) splice site probably benign
IGL00765:Htt APN 5 35,034,769 (GRCm39) splice site probably benign
IGL00950:Htt APN 5 35,048,785 (GRCm39) missense probably benign
IGL00953:Htt APN 5 34,976,021 (GRCm39) missense probably benign 0.04
IGL00957:Htt APN 5 34,964,068 (GRCm39) missense probably benign
IGL01314:Htt APN 5 35,036,200 (GRCm39) missense probably benign
IGL01412:Htt APN 5 35,055,916 (GRCm39) missense probably damaging 0.98
IGL01510:Htt APN 5 35,064,856 (GRCm39) missense probably damaging 1.00
IGL01617:Htt APN 5 35,034,099 (GRCm39) missense possibly damaging 0.67
IGL01893:Htt APN 5 35,034,174 (GRCm39) missense probably damaging 1.00
IGL01914:Htt APN 5 34,987,053 (GRCm39) missense probably benign
IGL01994:Htt APN 5 34,989,948 (GRCm39) missense possibly damaging 0.83
IGL02102:Htt APN 5 35,048,825 (GRCm39) splice site probably benign
IGL02381:Htt APN 5 34,987,104 (GRCm39) missense probably benign 0.03
IGL02529:Htt APN 5 34,976,387 (GRCm39) splice site probably benign
IGL02678:Htt APN 5 35,057,246 (GRCm39) missense probably damaging 1.00
IGL02707:Htt APN 5 34,987,225 (GRCm39) critical splice donor site probably null
IGL02731:Htt APN 5 34,961,137 (GRCm39) missense probably benign 0.41
IGL02931:Htt APN 5 35,034,097 (GRCm39) missense probably damaging 1.00
IGL03167:Htt APN 5 34,976,330 (GRCm39) missense probably damaging 0.98
IGL03343:Htt APN 5 34,983,385 (GRCm39) missense probably benign
IGL03344:Htt APN 5 35,037,172 (GRCm39) missense probably benign 0.39
IGL03344:Htt APN 5 35,064,810 (GRCm39) missense probably benign 0.02
IGL03366:Htt APN 5 35,064,924 (GRCm39) missense probably damaging 1.00
IGL03410:Htt APN 5 34,956,789 (GRCm39) missense probably damaging 0.99
Chalk UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
IGL02796:Htt UTSW 5 35,034,826 (GRCm39) missense probably benign 0.43
PIT4377001:Htt UTSW 5 35,033,309 (GRCm39) missense probably benign 0.10
R0013:Htt UTSW 5 34,977,448 (GRCm39) missense probably benign 0.25
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0049:Htt UTSW 5 35,066,006 (GRCm39) missense probably damaging 0.97
R0056:Htt UTSW 5 34,983,422 (GRCm39) splice site probably benign
R0207:Htt UTSW 5 35,054,252 (GRCm39) missense probably benign 0.11
R0329:Htt UTSW 5 34,974,478 (GRCm39) splice site probably benign
R0494:Htt UTSW 5 34,979,188 (GRCm39) missense possibly damaging 0.73
R0548:Htt UTSW 5 35,028,090 (GRCm39) missense probably damaging 1.00
R0601:Htt UTSW 5 35,003,347 (GRCm39) missense probably benign 0.08
R0799:Htt UTSW 5 34,975,097 (GRCm39) missense probably benign 0.00
R0947:Htt UTSW 5 35,056,268 (GRCm39) missense probably damaging 1.00
R1053:Htt UTSW 5 35,008,561 (GRCm39) critical splice acceptor site probably null
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1147:Htt UTSW 5 35,008,596 (GRCm39) missense probably damaging 0.98
R1478:Htt UTSW 5 34,961,171 (GRCm39) missense probably damaging 0.99
R1573:Htt UTSW 5 35,021,718 (GRCm39) splice site probably benign
R1677:Htt UTSW 5 34,985,918 (GRCm39) missense probably damaging 1.00
R1792:Htt UTSW 5 35,064,543 (GRCm39) missense probably damaging 1.00
R1816:Htt UTSW 5 34,961,084 (GRCm39) missense probably benign 0.01
R1833:Htt UTSW 5 35,063,092 (GRCm39) splice site probably benign
R1837:Htt UTSW 5 34,976,367 (GRCm39) missense probably benign 0.00
R1846:Htt UTSW 5 35,006,288 (GRCm39) missense probably damaging 0.98
R1875:Htt UTSW 5 34,951,456 (GRCm39) missense probably benign 0.05
R1899:Htt UTSW 5 35,064,429 (GRCm39) missense probably benign 0.01
R2013:Htt UTSW 5 35,010,215 (GRCm39) missense probably damaging 0.99
R2062:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2064:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2068:Htt UTSW 5 34,983,326 (GRCm39) missense probably benign 0.00
R2131:Htt UTSW 5 35,034,453 (GRCm39) missense possibly damaging 0.50
R2162:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R2169:Htt UTSW 5 35,034,819 (GRCm39) missense probably benign 0.08
R2345:Htt UTSW 5 34,983,348 (GRCm39) missense possibly damaging 0.80
R2433:Htt UTSW 5 35,064,885 (GRCm39) missense possibly damaging 0.65
R3027:Htt UTSW 5 34,977,439 (GRCm39) missense possibly damaging 0.85
R3123:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3125:Htt UTSW 5 34,961,875 (GRCm39) missense probably benign
R3717:Htt UTSW 5 34,968,866 (GRCm39) splice site probably benign
R3758:Htt UTSW 5 35,053,314 (GRCm39) missense probably damaging 0.97
R3805:Htt UTSW 5 35,034,548 (GRCm39) splice site probably null
R3833:Htt UTSW 5 34,979,062 (GRCm39) missense probably benign 0.44
R4066:Htt UTSW 5 35,036,191 (GRCm39) missense probably benign
R4272:Htt UTSW 5 35,006,413 (GRCm39) missense possibly damaging 0.96
R4625:Htt UTSW 5 34,987,129 (GRCm39) missense probably damaging 0.99
R4634:Htt UTSW 5 35,033,292 (GRCm39) missense probably benign 0.06
R4655:Htt UTSW 5 35,063,476 (GRCm39) missense probably benign 0.06
R4679:Htt UTSW 5 34,977,424 (GRCm39) missense probably benign
R4684:Htt UTSW 5 35,010,109 (GRCm39) missense probably damaging 1.00
R4832:Htt UTSW 5 34,982,184 (GRCm39) missense probably benign 0.01
R4833:Htt UTSW 5 35,009,569 (GRCm39) missense probably damaging 0.98
R4973:Htt UTSW 5 34,970,367 (GRCm39) missense probably damaging 0.99
R5095:Htt UTSW 5 34,981,739 (GRCm39) missense possibly damaging 0.89
R5132:Htt UTSW 5 35,063,023 (GRCm39) missense possibly damaging 0.89
R5351:Htt UTSW 5 34,961,177 (GRCm39) missense probably damaging 0.99
R5361:Htt UTSW 5 35,064,928 (GRCm39) missense possibly damaging 0.47
R5399:Htt UTSW 5 35,034,495 (GRCm39) missense probably damaging 0.98
R5462:Htt UTSW 5 35,042,851 (GRCm39) nonsense probably null
R5552:Htt UTSW 5 34,979,118 (GRCm39) missense probably benign
R5566:Htt UTSW 5 35,006,419 (GRCm39) missense probably damaging 1.00
R5595:Htt UTSW 5 35,062,741 (GRCm39) missense probably damaging 0.96
R5617:Htt UTSW 5 35,028,150 (GRCm39) missense possibly damaging 0.77
R5835:Htt UTSW 5 34,970,534 (GRCm39) missense probably benign 0.16
R5891:Htt UTSW 5 35,028,167 (GRCm39) missense possibly damaging 0.62
R6158:Htt UTSW 5 35,064,430 (GRCm39) missense possibly damaging 0.86
R6159:Htt UTSW 5 34,962,020 (GRCm39) missense probably benign 0.08
R6169:Htt UTSW 5 35,064,817 (GRCm39) missense probably damaging 1.00
R6242:Htt UTSW 5 35,003,356 (GRCm39) missense probably damaging 1.00
R6274:Htt UTSW 5 35,009,431 (GRCm39) missense possibly damaging 0.81
R6280:Htt UTSW 5 35,028,103 (GRCm39) missense probably benign 0.00
R6294:Htt UTSW 5 34,979,170 (GRCm39) missense probably benign
R6331:Htt UTSW 5 35,053,231 (GRCm39) missense possibly damaging 0.89
R6448:Htt UTSW 5 35,033,336 (GRCm39) missense probably benign 0.05
R6474:Htt UTSW 5 34,982,239 (GRCm39) missense probably benign 0.06
R6592:Htt UTSW 5 35,034,388 (GRCm39) missense possibly damaging 0.92
R6818:Htt UTSW 5 34,940,111 (GRCm39) missense probably damaging 0.99
R6830:Htt UTSW 5 34,991,670 (GRCm39) missense possibly damaging 0.82
R6920:Htt UTSW 5 35,034,444 (GRCm39) missense probably null 1.00
R6962:Htt UTSW 5 35,057,115 (GRCm39) critical splice acceptor site probably null
R7057:Htt UTSW 5 34,979,067 (GRCm39) missense probably null 0.05
R7144:Htt UTSW 5 35,003,350 (GRCm39) missense probably damaging 1.00
R7166:Htt UTSW 5 35,010,238 (GRCm39) missense probably benign 0.42
R7329:Htt UTSW 5 34,987,099 (GRCm39) missense probably benign 0.03
R7378:Htt UTSW 5 34,961,143 (GRCm39) missense probably benign 0.04
R7418:Htt UTSW 5 34,947,697 (GRCm39) missense possibly damaging 0.55
R7495:Htt UTSW 5 34,968,821 (GRCm39) missense probably benign 0.00
R7554:Htt UTSW 5 35,022,084 (GRCm39) missense probably damaging 0.97
R7575:Htt UTSW 5 35,062,987 (GRCm39) missense probably damaging 1.00
R7763:Htt UTSW 5 35,009,534 (GRCm39) missense probably damaging 1.00
R7782:Htt UTSW 5 35,040,336 (GRCm39) missense probably benign 0.03
R7850:Htt UTSW 5 35,009,631 (GRCm39) splice site probably null
R7870:Htt UTSW 5 35,055,891 (GRCm39) missense possibly damaging 0.77
R7871:Htt UTSW 5 35,021,993 (GRCm39) missense probably benign 0.00
R7879:Htt UTSW 5 34,981,252 (GRCm39) missense probably benign
R7992:Htt UTSW 5 34,987,225 (GRCm39) critical splice donor site probably null
R8058:Htt UTSW 5 34,977,444 (GRCm39) missense probably benign
R8168:Htt UTSW 5 35,040,300 (GRCm39) missense probably benign 0.00
R8188:Htt UTSW 5 34,919,287 (GRCm39) missense probably benign 0.03
R8262:Htt UTSW 5 35,053,304 (GRCm39) missense probably benign
R8343:Htt UTSW 5 35,063,068 (GRCm39) missense probably damaging 1.00
R8353:Htt UTSW 5 35,034,499 (GRCm39) missense possibly damaging 0.49
R8769:Htt UTSW 5 34,977,633 (GRCm39) missense probably benign 0.05
R8808:Htt UTSW 5 35,046,791 (GRCm39) missense probably benign 0.10
R8825:Htt UTSW 5 34,983,304 (GRCm39) missense probably benign 0.24
R8843:Htt UTSW 5 35,046,809 (GRCm39) missense possibly damaging 0.92
R8856:Htt UTSW 5 35,060,675 (GRCm39) missense probably benign 0.44
R8882:Htt UTSW 5 34,979,061 (GRCm39) missense probably benign
R8898:Htt UTSW 5 34,976,376 (GRCm39) missense probably benign 0.01
R8964:Htt UTSW 5 35,062,720 (GRCm39) missense probably benign 0.09
R8987:Htt UTSW 5 34,977,368 (GRCm39) missense probably benign 0.18
R8991:Htt UTSW 5 35,063,062 (GRCm39) missense probably damaging 1.00
R9005:Htt UTSW 5 34,975,095 (GRCm39) missense possibly damaging 0.92
R9019:Htt UTSW 5 35,023,920 (GRCm39) missense probably damaging 1.00
R9057:Htt UTSW 5 35,009,454 (GRCm39) missense possibly damaging 0.86
R9157:Htt UTSW 5 34,987,171 (GRCm39) missense probably null 0.89
R9205:Htt UTSW 5 34,976,367 (GRCm39) missense probably benign 0.00
R9223:Htt UTSW 5 35,062,692 (GRCm39) missense probably benign 0.01
R9243:Htt UTSW 5 35,056,276 (GRCm39) splice site probably benign
R9329:Htt UTSW 5 34,989,957 (GRCm39) missense possibly damaging 0.69
R9355:Htt UTSW 5 35,053,247 (GRCm39) missense probably benign
R9402:Htt UTSW 5 35,006,324 (GRCm39) missense probably damaging 1.00
R9446:Htt UTSW 5 34,919,272 (GRCm39) missense probably benign
R9716:Htt UTSW 5 35,012,019 (GRCm39) missense probably damaging 1.00
Z1177:Htt UTSW 5 35,009,575 (GRCm39) missense probably null 0.87
Predicted Primers PCR Primer
(F):5'- GCAGCACACGGTAATGAGTG -3'
(R):5'- GTGCTACTTTGGAATCTGTTGAAAG -3'

Sequencing Primer
(F):5'- GGAAAGACCTTTTGCATGCTAAGC -3'
(R):5'- TGGAATCTGTTGAAAGAACTACAC -3'
Posted On 2014-09-17