Incidental Mutation 'R2067:Bod1l'
ID 226751
Institutional Source Beutler Lab
Gene Symbol Bod1l
Ensembl Gene ENSMUSG00000061755
Gene Name biorientation of chromosomes in cell division 1-like
Synonyms A230054D04Rik
MMRRC Submission 040072-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.952) question?
Stock # R2067 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 41944881-42001658 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 41974429 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 2295 (T2295M)
Ref Sequence ENSEMBL: ENSMUSP00000144359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050556] [ENSMUST00000202908]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000050556
AA Change: T2295M

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000058618
Gene: ENSMUSG00000061755
AA Change: T2295M

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 1.8e-28 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 3.21e-1 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201291
Predicted Effect probably benign
Transcript: ENSMUST00000202908
AA Change: T2295M

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144359
Gene: ENSMUSG00000061755
AA Change: T2295M

DomainStartEndE-ValueType
low complexity region 5 47 N/A INTRINSIC
Pfam:COMPASS-Shg1 54 150 2.9e-24 PFAM
low complexity region 328 343 N/A INTRINSIC
low complexity region 415 435 N/A INTRINSIC
low complexity region 475 484 N/A INTRINSIC
coiled coil region 495 520 N/A INTRINSIC
coiled coil region 553 580 N/A INTRINSIC
low complexity region 820 840 N/A INTRINSIC
low complexity region 895 916 N/A INTRINSIC
low complexity region 996 1005 N/A INTRINSIC
low complexity region 1023 1041 N/A INTRINSIC
low complexity region 1272 1286 N/A INTRINSIC
low complexity region 1791 1809 N/A INTRINSIC
low complexity region 2695 2701 N/A INTRINSIC
low complexity region 2711 2729 N/A INTRINSIC
AT_hook 2807 2819 1.9e-3 SMART
coiled coil region 2908 2929 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,583,115 (GRCm39) probably benign Het
Abca2 A T 2: 25,327,517 (GRCm39) I669F possibly damaging Het
Acin1 T A 14: 54,902,711 (GRCm39) Q360H probably damaging Het
Aldh3b1 T A 19: 3,971,755 (GRCm39) D72V probably benign Het
Alox12e G A 11: 70,206,828 (GRCm39) R620W probably damaging Het
Alpl T C 4: 137,476,856 (GRCm39) probably benign Het
Amy2a1 T C 3: 113,324,217 (GRCm39) I108V probably benign Het
Ascc2 A T 11: 4,631,496 (GRCm39) M646L probably benign Het
Ccdc9 A T 7: 16,012,475 (GRCm39) probably null Het
Clptm1l C T 13: 73,755,842 (GRCm39) Q153* probably null Het
Csmd1 A G 8: 15,950,782 (GRCm39) S3476P probably benign Het
Ddias A T 7: 92,508,907 (GRCm39) M336K possibly damaging Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Epha1 G T 6: 42,342,987 (GRCm39) H187Q probably benign Het
Espl1 T C 15: 102,207,525 (GRCm39) S330P probably damaging Het
Fbln7 G T 2: 128,719,386 (GRCm39) R61L probably damaging Het
Fbxo41 C T 6: 85,455,453 (GRCm39) W577* probably null Het
Fgb C A 3: 82,956,996 (GRCm39) D25Y probably benign Het
Gc T A 5: 89,594,376 (GRCm39) K37N probably damaging Het
Gfpt1 T C 6: 87,034,736 (GRCm39) I178T probably benign Het
Gm12695 T C 4: 96,657,963 (GRCm39) T69A probably benign Het
Gm3944 C A 12: 18,903,895 (GRCm39) S8* probably null Het
Gm9912 T C 3: 148,890,795 (GRCm39) T113A unknown Het
Gpr156 A G 16: 37,799,113 (GRCm39) D109G probably benign Het
Hoxd1 A T 2: 74,593,710 (GRCm39) T89S probably benign Het
Htt C T 5: 34,983,326 (GRCm39) T975I probably benign Het
Itpr3 G A 17: 27,317,050 (GRCm39) M768I probably benign Het
Krt4 C A 15: 101,833,099 (GRCm39) A3S possibly damaging Het
Mrto4 T C 4: 139,076,334 (GRCm39) K86E probably benign Het
Mup4 T A 4: 59,960,622 (GRCm39) probably benign Het
Myh1 G A 11: 67,105,446 (GRCm39) D1079N possibly damaging Het
Myo1a A G 10: 127,541,347 (GRCm39) N43D probably benign Het
Napa A T 7: 15,849,203 (GRCm39) probably benign Het
Ndufa12 A G 10: 94,056,569 (GRCm39) D99G probably damaging Het
Neb A G 2: 52,174,275 (GRCm39) I1528T probably benign Het
Nek1 T C 8: 61,460,196 (GRCm39) S41P probably damaging Het
Nolc1 C T 19: 46,072,046 (GRCm39) T612M probably damaging Het
Nsun5 T G 5: 135,403,926 (GRCm39) Y301D probably damaging Het
Oas1g T C 5: 121,023,946 (GRCm39) E121G probably damaging Het
Or1e1f A G 11: 73,855,740 (GRCm39) Y102C probably damaging Het
Or2ab1 A G 11: 58,488,396 (GRCm39) N58S probably damaging Het
Or5d41 A G 2: 88,054,818 (GRCm39) V186A possibly damaging Het
Or6ae1 T A 7: 139,742,822 (GRCm39) I14F possibly damaging Het
Or8b46 T A 9: 38,450,576 (GRCm39) N128K probably benign Het
Or8k38 G T 2: 86,488,781 (GRCm39) T7K probably damaging Het
Osmr T C 15: 6,844,896 (GRCm39) N957D probably benign Het
Parn G A 16: 13,420,933 (GRCm39) S473L probably damaging Het
Phc2 T C 4: 128,640,929 (GRCm39) F672S probably damaging Het
Pik3c2b T C 1: 133,027,349 (GRCm39) S1283P probably damaging Het
Pole2 G A 12: 69,274,926 (GRCm39) R5W probably benign Het
Prl7a2 T A 13: 27,844,870 (GRCm39) Y172F probably damaging Het
Ptprz1 A G 6: 23,050,388 (GRCm39) probably benign Het
Rapgef3 C A 15: 97,664,842 (GRCm39) G7V probably damaging Het
Ripor1 T A 8: 106,344,340 (GRCm39) S491R probably benign Het
Rnf141 A G 7: 110,420,572 (GRCm39) probably benign Het
Ryr3 C T 2: 112,777,302 (GRCm39) R285Q probably damaging Het
Sall4 T C 2: 168,598,465 (GRCm39) N125S probably benign Het
Schip1 A G 3: 68,525,119 (GRCm39) K360R probably damaging Het
Senp6 T A 9: 79,997,151 (GRCm39) V55E probably benign Het
Skint1 T A 4: 111,882,730 (GRCm39) V258D probably benign Het
Slc25a16 T A 10: 62,768,530 (GRCm39) H130Q probably benign Het
Styx T C 14: 45,611,020 (GRCm39) V217A probably benign Het
Syne2 G A 12: 75,935,116 (GRCm39) probably null Het
Tagap1 A G 17: 7,224,259 (GRCm39) S146P probably benign Het
Tatdn2 A G 6: 113,681,103 (GRCm39) K379E probably benign Het
Thrap3 T C 4: 126,069,189 (GRCm39) Y654C possibly damaging Het
Tle2 T C 10: 81,416,385 (GRCm39) L135P probably damaging Het
Tmc1 A G 19: 20,801,673 (GRCm39) F451S possibly damaging Het
Trpm7 G A 2: 126,639,647 (GRCm39) P1650S probably damaging Het
Ttll4 G A 1: 74,719,541 (GRCm39) R16H possibly damaging Het
Ttn T C 2: 76,544,717 (GRCm39) N32795S probably damaging Het
Tubgcp6 T C 15: 88,988,692 (GRCm39) E803G probably benign Het
Ubr2 A G 17: 47,274,071 (GRCm39) probably null Het
Ugt2b35 A G 5: 87,149,412 (GRCm39) D221G probably damaging Het
Unc45b G A 11: 82,802,515 (GRCm39) A4T probably benign Het
Vmn1r70 A T 7: 10,368,264 (GRCm39) I251F possibly damaging Het
Vmn2r120 T A 17: 57,831,553 (GRCm39) H412L possibly damaging Het
Zfp59 A G 7: 27,552,935 (GRCm39) N129S probably benign Het
Zgrf1 T C 3: 127,406,999 (GRCm39) C1589R probably damaging Het
Other mutations in Bod1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Bod1l APN 5 41,974,166 (GRCm39) missense probably benign 0.00
IGL00990:Bod1l APN 5 41,986,208 (GRCm39) missense probably benign 0.00
IGL01021:Bod1l APN 5 41,995,516 (GRCm39) splice site probably benign
IGL01022:Bod1l APN 5 41,951,652 (GRCm39) missense probably damaging 1.00
IGL01303:Bod1l APN 5 41,974,942 (GRCm39) missense probably benign 0.00
IGL01654:Bod1l APN 5 41,975,519 (GRCm39) missense probably damaging 0.99
IGL01748:Bod1l APN 5 41,974,304 (GRCm39) missense probably benign 0.23
IGL01758:Bod1l APN 5 41,983,953 (GRCm39) splice site probably benign
IGL01783:Bod1l APN 5 41,966,055 (GRCm39) missense probably benign 0.02
IGL01790:Bod1l APN 5 41,989,593 (GRCm39) missense probably benign 0.14
IGL01803:Bod1l APN 5 41,974,732 (GRCm39) missense probably damaging 0.97
IGL01829:Bod1l APN 5 41,977,811 (GRCm39) missense probably benign 0.25
IGL01952:Bod1l APN 5 41,974,297 (GRCm39) missense possibly damaging 0.70
IGL02005:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02110:Bod1l APN 5 41,973,796 (GRCm39) missense probably damaging 0.97
IGL02129:Bod1l APN 5 41,979,193 (GRCm39) missense probably benign 0.36
IGL02572:Bod1l APN 5 41,978,573 (GRCm39) nonsense probably null
IGL02583:Bod1l APN 5 41,973,550 (GRCm39) critical splice donor site probably null
IGL02643:Bod1l APN 5 41,976,148 (GRCm39) missense possibly damaging 0.65
IGL02714:Bod1l APN 5 41,973,682 (GRCm39) missense probably benign 0.01
IGL02728:Bod1l APN 5 41,983,846 (GRCm39) missense probably damaging 1.00
IGL02752:Bod1l APN 5 41,973,806 (GRCm39) missense possibly damaging 0.58
IGL02822:Bod1l APN 5 41,951,688 (GRCm39) missense possibly damaging 0.94
IGL03032:Bod1l APN 5 41,988,927 (GRCm39) missense probably benign 0.16
IGL03372:Bod1l APN 5 41,962,578 (GRCm39) splice site probably benign
capacitance UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
gauss UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
Tesla UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R0102:Bod1l UTSW 5 41,974,612 (GRCm39) missense probably benign 0.36
R0147:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0148:Bod1l UTSW 5 41,976,040 (GRCm39) missense possibly damaging 0.48
R0490:Bod1l UTSW 5 41,979,235 (GRCm39) missense probably damaging 0.96
R0577:Bod1l UTSW 5 41,952,230 (GRCm39) missense probably damaging 1.00
R0587:Bod1l UTSW 5 41,978,980 (GRCm39) missense probably benign 0.16
R0620:Bod1l UTSW 5 41,958,576 (GRCm39) missense probably benign 0.16
R0626:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R0785:Bod1l UTSW 5 41,977,359 (GRCm39) missense probably benign 0.00
R1139:Bod1l UTSW 5 41,988,814 (GRCm39) missense possibly damaging 0.64
R1165:Bod1l UTSW 5 41,978,396 (GRCm39) missense probably benign 0.02
R1418:Bod1l UTSW 5 41,976,814 (GRCm39) missense probably damaging 1.00
R1509:Bod1l UTSW 5 41,976,883 (GRCm39) missense probably damaging 0.99
R1533:Bod1l UTSW 5 41,979,498 (GRCm39) nonsense probably null
R1538:Bod1l UTSW 5 41,973,772 (GRCm39) missense probably benign 0.00
R1591:Bod1l UTSW 5 41,976,563 (GRCm39) missense probably benign 0.06
R1616:Bod1l UTSW 5 41,966,058 (GRCm39) missense probably benign
R1628:Bod1l UTSW 5 41,974,325 (GRCm39) missense probably benign 0.01
R1667:Bod1l UTSW 5 41,974,118 (GRCm39) missense probably benign 0.01
R1869:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1870:Bod1l UTSW 5 41,991,018 (GRCm39) missense possibly damaging 0.93
R1993:Bod1l UTSW 5 41,974,679 (GRCm39) missense probably damaging 1.00
R2060:Bod1l UTSW 5 41,966,085 (GRCm39) missense possibly damaging 0.58
R2066:Bod1l UTSW 5 41,962,499 (GRCm39) missense probably damaging 0.99
R2073:Bod1l UTSW 5 41,976,532 (GRCm39) missense probably benign 0.19
R2092:Bod1l UTSW 5 41,988,860 (GRCm39) missense probably damaging 1.00
R2105:Bod1l UTSW 5 41,989,622 (GRCm39) missense probably benign 0.00
R2243:Bod1l UTSW 5 41,978,888 (GRCm39) missense possibly damaging 0.58
R2322:Bod1l UTSW 5 41,984,463 (GRCm39) missense probably benign 0.09
R2849:Bod1l UTSW 5 41,995,419 (GRCm39) missense probably damaging 1.00
R2883:Bod1l UTSW 5 41,989,602 (GRCm39) missense probably benign 0.03
R3037:Bod1l UTSW 5 41,979,380 (GRCm39) missense probably damaging 0.99
R3910:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3911:Bod1l UTSW 5 41,974,441 (GRCm39) missense probably damaging 0.99
R3962:Bod1l UTSW 5 41,966,064 (GRCm39) missense probably benign 0.07
R4235:Bod1l UTSW 5 41,978,798 (GRCm39) missense probably damaging 1.00
R4308:Bod1l UTSW 5 41,949,156 (GRCm39) missense possibly damaging 0.91
R4414:Bod1l UTSW 5 41,977,870 (GRCm39) missense probably benign 0.04
R4535:Bod1l UTSW 5 41,989,574 (GRCm39) missense probably benign 0.06
R4631:Bod1l UTSW 5 41,975,078 (GRCm39) missense probably damaging 1.00
R4657:Bod1l UTSW 5 41,975,955 (GRCm39) missense probably benign 0.00
R4782:Bod1l UTSW 5 41,991,006 (GRCm39) missense probably benign 0.06
R4786:Bod1l UTSW 5 41,976,781 (GRCm39) missense probably benign 0.43
R4840:Bod1l UTSW 5 41,975,815 (GRCm39) missense probably damaging 1.00
R4877:Bod1l UTSW 5 41,977,337 (GRCm39) missense probably benign 0.00
R4982:Bod1l UTSW 5 41,977,816 (GRCm39) missense probably benign 0.00
R5152:Bod1l UTSW 5 41,973,886 (GRCm39) missense probably benign 0.04
R5284:Bod1l UTSW 5 41,977,810 (GRCm39) missense probably benign 0.05
R5354:Bod1l UTSW 5 41,988,880 (GRCm39) missense probably damaging 1.00
R5369:Bod1l UTSW 5 41,984,526 (GRCm39) missense probably damaging 1.00
R5486:Bod1l UTSW 5 41,964,524 (GRCm39) missense possibly damaging 0.56
R5541:Bod1l UTSW 5 41,949,276 (GRCm39) missense probably benign 0.06
R5610:Bod1l UTSW 5 41,979,217 (GRCm39) missense probably damaging 1.00
R5655:Bod1l UTSW 5 41,974,387 (GRCm39) missense probably benign 0.06
R5705:Bod1l UTSW 5 41,974,345 (GRCm39) missense probably benign 0.01
R5819:Bod1l UTSW 5 41,989,948 (GRCm39) missense probably benign 0.27
R5890:Bod1l UTSW 5 41,977,921 (GRCm39) missense probably benign 0.43
R5923:Bod1l UTSW 5 41,974,762 (GRCm39) missense probably damaging 1.00
R5991:Bod1l UTSW 5 41,974,206 (GRCm39) nonsense probably null
R6017:Bod1l UTSW 5 41,976,103 (GRCm39) missense probably benign 0.01
R6253:Bod1l UTSW 5 41,983,881 (GRCm39) missense probably damaging 0.96
R6284:Bod1l UTSW 5 41,976,130 (GRCm39) missense probably benign 0.35
R6483:Bod1l UTSW 5 41,978,425 (GRCm39) missense probably benign 0.03
R6485:Bod1l UTSW 5 41,974,459 (GRCm39) missense possibly damaging 0.93
R6575:Bod1l UTSW 5 41,995,411 (GRCm39) missense probably damaging 1.00
R6679:Bod1l UTSW 5 41,974,009 (GRCm39) missense probably damaging 0.97
R6788:Bod1l UTSW 5 41,979,216 (GRCm39) nonsense probably null
R7006:Bod1l UTSW 5 41,989,895 (GRCm39) missense probably damaging 1.00
R7095:Bod1l UTSW 5 41,952,411 (GRCm39) critical splice donor site probably null
R7111:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7190:Bod1l UTSW 5 41,977,281 (GRCm39) missense probably benign 0.14
R7311:Bod1l UTSW 5 41,951,676 (GRCm39) missense possibly damaging 0.57
R7336:Bod1l UTSW 5 41,978,867 (GRCm39) missense probably damaging 1.00
R7341:Bod1l UTSW 5 41,946,200 (GRCm39) missense probably benign 0.00
R7396:Bod1l UTSW 5 41,988,889 (GRCm39) missense probably damaging 1.00
R7431:Bod1l UTSW 5 41,970,463 (GRCm39) critical splice donor site probably null
R7442:Bod1l UTSW 5 41,964,522 (GRCm39) missense probably damaging 0.96
R7539:Bod1l UTSW 5 41,975,203 (GRCm39) missense possibly damaging 0.65
R7583:Bod1l UTSW 5 41,991,133 (GRCm39) missense probably damaging 1.00
R7679:Bod1l UTSW 5 41,977,986 (GRCm39) frame shift probably null
R7748:Bod1l UTSW 5 41,989,683 (GRCm39) missense probably damaging 0.97
R7767:Bod1l UTSW 5 41,974,099 (GRCm39) missense probably benign 0.01
R7773:Bod1l UTSW 5 41,990,055 (GRCm39) missense probably benign 0.14
R7782:Bod1l UTSW 5 41,975,286 (GRCm39) missense probably benign 0.01
R7860:Bod1l UTSW 5 41,976,608 (GRCm39) missense probably damaging 1.00
R7975:Bod1l UTSW 5 41,973,620 (GRCm39) missense possibly damaging 0.90
R7977:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R7987:Bod1l UTSW 5 41,952,413 (GRCm39) missense probably damaging 1.00
R8104:Bod1l UTSW 5 41,991,075 (GRCm39) nonsense probably null
R8217:Bod1l UTSW 5 41,988,850 (GRCm39) missense probably damaging 1.00
R8307:Bod1l UTSW 5 41,978,498 (GRCm39) missense probably damaging 1.00
R8469:Bod1l UTSW 5 41,978,834 (GRCm39) missense possibly damaging 0.86
R8506:Bod1l UTSW 5 41,976,398 (GRCm39) nonsense probably null
R8934:Bod1l UTSW 5 41,976,944 (GRCm39) missense probably benign 0.11
R8984:Bod1l UTSW 5 41,946,215 (GRCm39) missense probably damaging 1.00
R8989:Bod1l UTSW 5 41,979,025 (GRCm39) missense probably benign 0.00
R8993:Bod1l UTSW 5 41,974,210 (GRCm39) missense probably benign 0.01
R9128:Bod1l UTSW 5 41,946,266 (GRCm39) missense probably benign 0.22
R9129:Bod1l UTSW 5 41,976,220 (GRCm39) missense probably damaging 0.99
R9198:Bod1l UTSW 5 41,957,129 (GRCm39) missense probably benign 0.08
R9254:Bod1l UTSW 5 41,979,223 (GRCm39) missense probably damaging 1.00
R9445:Bod1l UTSW 5 41,974,619 (GRCm39) missense probably benign 0.04
R9457:Bod1l UTSW 5 41,979,310 (GRCm39) missense probably damaging 0.99
R9470:Bod1l UTSW 5 41,974,439 (GRCm39) missense probably damaging 0.99
R9536:Bod1l UTSW 5 41,974,305 (GRCm39) missense probably benign 0.01
R9654:Bod1l UTSW 5 41,975,707 (GRCm39) missense probably benign 0.02
R9734:Bod1l UTSW 5 41,962,573 (GRCm39) missense possibly damaging 0.91
R9771:Bod1l UTSW 5 41,949,206 (GRCm39) missense probably damaging 0.96
X0027:Bod1l UTSW 5 41,990,012 (GRCm39) missense probably benign 0.20
X0058:Bod1l UTSW 5 41,981,361 (GRCm39) missense probably damaging 1.00
Z1088:Bod1l UTSW 5 41,966,107 (GRCm39) missense possibly damaging 0.95
Z1088:Bod1l UTSW 5 41,978,489 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTGCCATTAAAGGACCTACTC -3'
(R):5'- TGAAGGCTCTGTGTCCAGTG -3'

Sequencing Primer
(F):5'- ACTCCTTTGCCCATCCTGAATG -3'
(R):5'- TGTCCCTCAGTCATACCAGTAGAGG -3'
Posted On 2014-09-17