Incidental Mutation 'R2067:Ugt2b35'
ID 226752
Institutional Source Beutler Lab
Gene Symbol Ugt2b35
Ensembl Gene ENSMUSG00000035811
Gene Name UDP glucuronosyltransferase 2 family, polypeptide B35
Synonyms
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R2067 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 87000860-87013275 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87001553 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 221 (D221G)
Ref Sequence ENSEMBL: ENSMUSP00000031186 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031186]
AlphaFold Q8BJL9
Predicted Effect probably damaging
Transcript: ENSMUST00000031186
AA Change: D221G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031186
Gene: ENSMUSG00000035811
AA Change: D221G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 526 1e-253 PFAM
Pfam:Glyco_tran_28_C 338 449 1.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200248
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Espl1 T C 15: 102,299,090 S330P probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Ripor1 T A 8: 105,617,708 S491R probably benign Het
Rnf141 A G 7: 110,821,365 probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Sall4 T C 2: 168,756,545 N125S probably benign Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Tubgcp6 T C 15: 89,104,489 E803G probably benign Het
Ubr2 A G 17: 46,963,145 probably null Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Ugt2b35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00703:Ugt2b35 APN 5 87008192 missense probably benign 0.00
IGL01109:Ugt2b35 APN 5 87008306 missense probably damaging 1.00
IGL01586:Ugt2b35 APN 5 87011391 missense probably benign 0.07
IGL02151:Ugt2b35 APN 5 87003282 missense possibly damaging 0.65
IGL02225:Ugt2b35 APN 5 87007405 splice site probably benign
IGL02483:Ugt2b35 APN 5 87001145 missense possibly damaging 0.87
IGL02504:Ugt2b35 APN 5 87001541 missense possibly damaging 0.50
IGL02690:Ugt2b35 APN 5 87001237 missense probably benign 0.01
IGL02954:Ugt2b35 APN 5 87011321 missense probably benign 0.00
IGL03242:Ugt2b35 APN 5 87007395 missense probably damaging 1.00
R0329:Ugt2b35 UTSW 5 87003405 missense probably null 0.38
R0513:Ugt2b35 UTSW 5 87003412 splice site probably benign
R0571:Ugt2b35 UTSW 5 87000934 missense possibly damaging 0.51
R0827:Ugt2b35 UTSW 5 87008130 splice site probably benign
R1396:Ugt2b35 UTSW 5 87011530 missense possibly damaging 0.56
R1437:Ugt2b35 UTSW 5 87001031 missense probably benign 0.02
R1557:Ugt2b35 UTSW 5 87007297 splice site probably null
R1869:Ugt2b35 UTSW 5 87001288 missense probably damaging 1.00
R1937:Ugt2b35 UTSW 5 87001282 missense probably damaging 1.00
R2219:Ugt2b35 UTSW 5 87003332 missense possibly damaging 0.81
R3055:Ugt2b35 UTSW 5 87001598 missense probably benign 0.05
R3793:Ugt2b35 UTSW 5 87001606 missense probably benign 0.15
R4452:Ugt2b35 UTSW 5 87003378 missense probably damaging 0.99
R4548:Ugt2b35 UTSW 5 87008275 nonsense probably null
R4902:Ugt2b35 UTSW 5 87003300 missense possibly damaging 0.89
R5311:Ugt2b35 UTSW 5 87011280 nonsense probably null
R6187:Ugt2b35 UTSW 5 87007322 missense probably damaging 0.98
R6332:Ugt2b35 UTSW 5 87001556 missense probably damaging 1.00
R6719:Ugt2b35 UTSW 5 87007388 missense probably damaging 1.00
R7211:Ugt2b35 UTSW 5 87001318 missense probably benign 0.39
R7652:Ugt2b35 UTSW 5 87001510 missense probably damaging 0.99
R7766:Ugt2b35 UTSW 5 87001202 missense possibly damaging 0.94
R7825:Ugt2b35 UTSW 5 87001359 nonsense probably null
R8188:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8189:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8191:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8192:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8193:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8220:Ugt2b35 UTSW 5 87001443 missense probably damaging 0.98
R8288:Ugt2b35 UTSW 5 87001457 missense probably damaging 1.00
R8695:Ugt2b35 UTSW 5 87008205 missense probably damaging 0.97
R8898:Ugt2b35 UTSW 5 87011330 missense possibly damaging 0.53
R8924:Ugt2b35 UTSW 5 87004921 missense possibly damaging 0.73
R8944:Ugt2b35 UTSW 5 87001451 missense probably benign 0.21
R9284:Ugt2b35 UTSW 5 87008281 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAACTGCTCCAGATTCC -3'
(R):5'- CAGGACTGATACCTTCTATTTGAAC -3'

Sequencing Primer
(F):5'- GCTCCAGATTCCTTTTCTGTACAG -3'
(R):5'- TGAGCTTTTACAGAGCATTCATG -3'
Posted On 2014-09-17