Incidental Mutation 'R2067:Fbxo41'
ID226759
Institutional Source Beutler Lab
Gene Symbol Fbxo41
Ensembl Gene ENSMUSG00000047013
Gene NameF-box protein 41
SynonymsD6Ertd538e
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.273) question?
Stock #R2067 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location85469574-85502994 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 85478471 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 577 (W577*)
Ref Sequence ENSEMBL: ENSMUSP00000124754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546]
Predicted Effect probably null
Transcript: ENSMUST00000159062
AA Change: W577*
SMART Domains Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013
AA Change: W577*

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161078
AA Change: W577*
SMART Domains Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013
AA Change: W577*

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000161546
AA Change: W577*
SMART Domains Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013
AA Change: W577*

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
Pfam:F-box-like 554 593 5.6e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family, which is characterized by an approximately 40 amino acid motif, the F-box. F-box proteins constitute one of the four subunits of the SCF ubiquitin protein ligase complex that plays a role in phosphorylation-dependent ubiquitination. F-box proteins are divided into three classes depending on the interaction substrate domain each contains in addition to the F-box motif: FBXW proteins contain WD-40 domains, FBXL proteins contain leucine-rich repeats, and FBXO proteins contain either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the FBXO class. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality and premature death by 10 weeks, growth retardation, abnormal gait, dragging hindlimbs, ataxia, impaired balance, impaired coordination, tremors and abnormal neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Espl1 T C 15: 102,299,090 S330P probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Ripor1 T A 8: 105,617,708 S491R probably benign Het
Rnf141 A G 7: 110,821,365 probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Sall4 T C 2: 168,756,545 N125S probably benign Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Tubgcp6 T C 15: 89,104,489 E803G probably benign Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b35 A G 5: 87,001,553 D221G probably damaging Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Fbxo41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Fbxo41 APN 6 85478102 splice site probably null
IGL00919:Fbxo41 APN 6 85478570 missense probably damaging 1.00
IGL01135:Fbxo41 APN 6 85477908 missense probably benign 0.41
IGL02084:Fbxo41 APN 6 85480765 critical splice donor site probably null
IGL02343:Fbxo41 APN 6 85478171 missense possibly damaging 0.78
IGL03284:Fbxo41 APN 6 85479765 missense probably damaging 1.00
R0116:Fbxo41 UTSW 6 85477908 missense probably damaging 1.00
R0452:Fbxo41 UTSW 6 85478182 missense probably damaging 1.00
R2064:Fbxo41 UTSW 6 85478471 nonsense probably null
R2065:Fbxo41 UTSW 6 85478471 nonsense probably null
R3433:Fbxo41 UTSW 6 85477631 missense probably damaging 1.00
R3522:Fbxo41 UTSW 6 85484181 missense probably benign 0.00
R4086:Fbxo41 UTSW 6 85478546 missense possibly damaging 0.93
R4520:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4521:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4522:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4523:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4524:Fbxo41 UTSW 6 85484042 missense probably damaging 1.00
R4867:Fbxo41 UTSW 6 85475194 missense probably benign
R4970:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5000:Fbxo41 UTSW 6 85483919 missense probably damaging 0.98
R5112:Fbxo41 UTSW 6 85477924 missense probably damaging 1.00
R5330:Fbxo41 UTSW 6 85479906 missense probably benign
R5331:Fbxo41 UTSW 6 85479906 missense probably benign
R5334:Fbxo41 UTSW 6 85478483 missense probably damaging 1.00
R5595:Fbxo41 UTSW 6 85479901 missense probably benign 0.00
R5632:Fbxo41 UTSW 6 85484504 missense probably damaging 1.00
R5698:Fbxo41 UTSW 6 85477656 missense possibly damaging 0.88
R5801:Fbxo41 UTSW 6 85484533 missense probably damaging 0.97
R5854:Fbxo41 UTSW 6 85475094 missense probably damaging 1.00
R6258:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6260:Fbxo41 UTSW 6 85478555 missense probably damaging 1.00
R6615:Fbxo41 UTSW 6 85478523 missense possibly damaging 0.60
R7061:Fbxo41 UTSW 6 85475466 missense probably benign 0.36
R7353:Fbxo41 UTSW 6 85479976 missense possibly damaging 0.71
R7681:Fbxo41 UTSW 6 85478479 nonsense probably null
R8077:Fbxo41 UTSW 6 85473229 missense probably damaging 0.98
X0024:Fbxo41 UTSW 6 85478470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGAGGTCTGAACTGGACTG -3'
(R):5'- TTCTCCAGCACGTCCTGAAG -3'

Sequencing Primer
(F):5'- TCTGAACTGGACTGGCTGGC -3'
(R):5'- TCCTGAAGGAGGCAGCG -3'
Posted On2014-09-17