Incidental Mutation 'R2067:Rnf141'
ID 226766
Institutional Source Beutler Lab
Gene Symbol Rnf141
Ensembl Gene ENSMUSG00000030788
Gene Name ring finger protein 141
Synonyms 2610110L04Rik, ZFP36, ZNF230
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.366) question?
Stock # R2067 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 110800432-110844457 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 110821365 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106682] [ENSMUST00000175981] [ENSMUST00000176746] [ENSMUST00000177236] [ENSMUST00000177462]
AlphaFold Q99MB7
Predicted Effect probably benign
Transcript: ENSMUST00000106682
SMART Domains Protein: ENSMUSP00000102293
Gene: ENSMUSG00000030788

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175648
Predicted Effect probably benign
Transcript: ENSMUST00000175981
SMART Domains Protein: ENSMUSP00000135123
Gene: ENSMUSG00000030788

DomainStartEndE-ValueType
RING 58 94 3.39e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176048
Predicted Effect probably benign
Transcript: ENSMUST00000176210
Predicted Effect probably benign
Transcript: ENSMUST00000176746
Predicted Effect probably benign
Transcript: ENSMUST00000177236
SMART Domains Protein: ENSMUSP00000134781
Gene: ENSMUSG00000030788

DomainStartEndE-ValueType
RING 155 191 3.39e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177462
SMART Domains Protein: ENSMUSP00000134917
Gene: ENSMUSG00000030788

DomainStartEndE-ValueType
PDB:2ECN|A 144 180 3e-21 PDB
SCOP:d1fbva4 146 180 3e-7 SMART
Blast:RING 155 180 6e-12 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif known to be involved in protein-DNA and protein-protein interactions. Abundant expression of this gene was found in the testicular tissue of fertile men, but was not detected in azoospermic patients. Studies of the mouse counterpart suggest that this gene may function as a testis specific transcription factor during spermatogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit decreased litter size but normal spermatogeness and testes weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Espl1 T C 15: 102,299,090 S330P probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Ripor1 T A 8: 105,617,708 S491R probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Sall4 T C 2: 168,756,545 N125S probably benign Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Tubgcp6 T C 15: 89,104,489 E803G probably benign Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b35 A G 5: 87,001,553 D221G probably damaging Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Rnf141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Rnf141 APN 7 110833734 unclassified probably benign
IGL02246:Rnf141 APN 7 110825287 missense probably benign
IGL02336:Rnf141 APN 7 110837198 nonsense probably null
R0482:Rnf141 UTSW 7 110837138 nonsense probably null
R1324:Rnf141 UTSW 7 110816843 nonsense probably null
R1718:Rnf141 UTSW 7 110821273 missense probably damaging 1.00
R4151:Rnf141 UTSW 7 110837199 missense probably benign 0.19
R4867:Rnf141 UTSW 7 110816768 missense probably damaging 1.00
R4869:Rnf141 UTSW 7 110825350 missense probably damaging 1.00
R4947:Rnf141 UTSW 7 110825320 missense possibly damaging 0.66
R5320:Rnf141 UTSW 7 110833803 missense probably damaging 1.00
R6364:Rnf141 UTSW 7 110821309 missense possibly damaging 0.75
R8219:Rnf141 UTSW 7 110837265 start gained probably benign
R8492:Rnf141 UTSW 7 110837200 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGTTGTTTAGTTACAGTCCCAGC -3'
(R):5'- CGGAAAGACTTGAGTTTGCAG -3'

Sequencing Primer
(F):5'- AGTTACAGTCCCAGCTGACCTG -3'
(R):5'- GAAACTTAACATCAGTGTTTCTTCCC -3'
Posted On 2014-09-17