Incidental Mutation 'R2067:Olfr522'
ID 226767
Institutional Source Beutler Lab
Gene Symbol Olfr522
Ensembl Gene ENSMUSG00000051180
Gene Name olfactory receptor 522
Synonyms MOR103-5, GA_x6K02T2PBJ9-42315125-42314187
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R2067 (G1)
Quality Score 202
Status Validated
Chromosome 7
Chromosomal Location 140159999-140164764 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 140162909 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 14 (I14F)
Ref Sequence ENSEMBL: ENSMUSP00000057288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050585]
AlphaFold Q8VGL1
Predicted Effect possibly damaging
Transcript: ENSMUST00000050585
AA Change: I14F

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057288
Gene: ENSMUSG00000051180
AA Change: I14F

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.7e-54 PFAM
Pfam:7tm_1 42 291 1.2e-21 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Espl1 T C 15: 102,299,090 S330P probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Ripor1 T A 8: 105,617,708 S491R probably benign Het
Rnf141 A G 7: 110,821,365 probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Sall4 T C 2: 168,756,545 N125S probably benign Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Tubgcp6 T C 15: 89,104,489 E803G probably benign Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b35 A G 5: 87,001,553 D221G probably damaging Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Olfr522
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01806:Olfr522 APN 7 140162928 missense probably benign 0.01
IGL02121:Olfr522 APN 7 140162694 missense probably benign 0.10
IGL02399:Olfr522 APN 7 140162600 missense probably benign
IGL02803:Olfr522 APN 7 140162374 missense possibly damaging 0.92
R0446:Olfr522 UTSW 7 140162471 missense probably damaging 1.00
R0538:Olfr522 UTSW 7 140162231 missense probably damaging 1.00
R0707:Olfr522 UTSW 7 140162089 missense probably damaging 1.00
R1466:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1466:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1584:Olfr522 UTSW 7 140162203 missense probably damaging 1.00
R1893:Olfr522 UTSW 7 140162821 missense probably damaging 1.00
R1895:Olfr522 UTSW 7 140162813 missense possibly damaging 0.82
R2004:Olfr522 UTSW 7 140162816 missense probably damaging 0.98
R2060:Olfr522 UTSW 7 140162824 missense probably damaging 1.00
R4841:Olfr522 UTSW 7 140162689 missense possibly damaging 0.94
R4842:Olfr522 UTSW 7 140162689 missense possibly damaging 0.94
R4956:Olfr522 UTSW 7 140162080 missense possibly damaging 0.70
R5189:Olfr522 UTSW 7 140162719 missense probably damaging 0.98
R5325:Olfr522 UTSW 7 140162113 missense probably damaging 1.00
R5441:Olfr522 UTSW 7 140162651 missense probably benign 0.36
R5618:Olfr522 UTSW 7 140162272 missense probably damaging 1.00
R6031:Olfr522 UTSW 7 140162809 missense possibly damaging 0.82
R6031:Olfr522 UTSW 7 140162809 missense possibly damaging 0.82
R6609:Olfr522 UTSW 7 140162563 missense probably benign
R7154:Olfr522 UTSW 7 140162084 missense probably benign 0.00
R8370:Olfr522 UTSW 7 140162768 missense probably damaging 0.98
R8765:Olfr522 UTSW 7 140162554 missense probably benign
R9002:Olfr522 UTSW 7 140162285 missense probably damaging 0.99
R9112:Olfr522 UTSW 7 140162747 missense
R9431:Olfr522 UTSW 7 140162029 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCACAGACAGATTGGCCAG -3'
(R):5'- CATCCCTGCAAACAAGGCTG -3'

Sequencing Primer
(F):5'- TTGGCCAGGAAGAAGTACATG -3'
(R):5'- GAGAAACATCCCTCGGTCCTG -3'
Posted On 2014-09-17