Mutagenetix > Incidental Mutations

Incidental Mutation 'R2067:Nek1'

226769

Institutional Source

Beutler Lab

Gene Symbol

Nek1

Ensembl Gene

ENSMUSG00000031644

Gene Name

NIMA (never in mitosis gene a)-related expressed kinase 1

Synonyms

kidney, anemia and testis, kat, D8Ertd790e

MMRRC Submission

040072-MU

Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2067 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60993195-61131346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 61007162 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 41 (S41P)

Ref Sequence

ENSEMBL: ENSMUSP00000113932 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034065
AA Change: S41P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: S41P

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	556	592	N/A	INTRINSIC
coiled coil region	647	685	N/A	INTRINSIC
low complexity region	767	780	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120689
AA Change: S41P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: S41P

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	487	510	N/A	INTRINSIC
low complexity region	521	533	N/A	INTRINSIC
coiled coil region	584	620	N/A	INTRINSIC
coiled coil region	675	713	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC
low complexity region	1158	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155664

Predicted Effect

probably damaging
Transcript: ENSMUST00000211256
AA Change: S41P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably benign
Transcript: ENSMUST00000211672
AA Change: S41P

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.1888

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

97% (76/78)

MGI Phenotype

Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530002B09Rik	T	A	4: 122,689,322		probably benign	Het
Abca2	A	T	2: 25,437,505	I669F	possibly damaging	Het
Acin1	T	A	14: 54,665,254	Q360H	probably damaging	Het
Aldh3b1	T	A	19: 3,921,755	D72V	probably benign	Het
Alox12e	G	A	11: 70,316,002	R620W	probably damaging	Het
Alpl	T	C	4: 137,749,545		probably benign	Het
Amy2a1	T	C	3: 113,530,568	I108V	probably benign	Het
Ascc2	A	T	11: 4,681,496	M646L	probably benign	Het
Bod1l	G	A	5: 41,817,086	T2295M	probably benign	Het
Ccdc9	A	T	7: 16,278,550		probably null	Het
Clptm1l	C	T	13: 73,607,723	Q153*	probably null	Het
Csmd1	A	G	8: 15,900,782	S3476P	probably benign	Het
Ddias	A	T	7: 92,859,699	M336K	possibly damaging	Het
Ehd1	T	C	19: 6,298,078	L362P	probably benign	Het
Epha1	G	T	6: 42,366,053	H187Q	probably benign	Het
Espl1	T	C	15: 102,299,090	S330P	probably damaging	Het
Fbln7	G	T	2: 128,877,466	R61L	probably damaging	Het
Fbxo41	C	T	6: 85,478,471	W577*	probably null	Het
Fgb	C	A	3: 83,049,689	D25Y	probably benign	Het
Gc	T	A	5: 89,446,517	K37N	probably damaging	Het
Gfpt1	T	C	6: 87,057,754	I178T	probably benign	Het
Gm12695	T	C	4: 96,769,726	T69A	probably benign	Het
Gm3944	C	A	12: 18,853,894	S8*	probably null	Het
Gm9912	T	C	3: 149,185,159	T113A	unknown	Het
Gpr156	A	G	16: 37,978,751	D109G	probably benign	Het
Hoxd1	A	T	2: 74,763,366	T89S	probably benign	Het
Htt	C	T	5: 34,825,982	T975I	probably benign	Het
Itpr3	G	A	17: 27,098,076	M768I	probably benign	Het
Krt4	C	A	15: 101,924,664	A3S	possibly damaging	Het
Mrto4	T	C	4: 139,349,023	K86E	probably benign	Het
Mup4	T	A	4: 59,960,622		probably benign	Het
Myh1	G	A	11: 67,214,620	D1079N	possibly damaging	Het
Myo1a	A	G	10: 127,705,478	N43D	probably benign	Het
Napa	A	T	7: 16,115,278		probably benign	Het
Ndufa12	A	G	10: 94,220,707	D99G	probably damaging	Het
Neb	A	G	2: 52,284,263	I1528T	probably benign	Het
Nolc1	C	T	19: 46,083,607	T612M	probably damaging	Het
Nsun5	T	G	5: 135,375,072	Y301D	probably damaging	Het
Oas1g	T	C	5: 120,885,883	E121G	probably damaging	Het
Olfr1085	G	T	2: 86,658,437	T7K	probably damaging	Het
Olfr1170	A	G	2: 88,224,474	V186A	possibly damaging	Het
Olfr324	A	G	11: 58,597,570	N58S	probably damaging	Het
Olfr397	A	G	11: 73,964,914	Y102C	probably damaging	Het
Olfr522	T	A	7: 140,162,909	I14F	possibly damaging	Het
Olfr910	T	A	9: 38,539,280	N128K	probably benign	Het
Osmr	T	C	15: 6,815,415	N957D	probably benign	Het
Parn	G	A	16: 13,603,069	S473L	probably damaging	Het
Phc2	T	C	4: 128,747,136	F672S	probably damaging	Het
Pik3c2b	T	C	1: 133,099,611	S1283P	probably damaging	Het
Pole2	G	A	12: 69,228,152	R5W	probably benign	Het
Prl7a2	T	A	13: 27,660,887	Y172F	probably damaging	Het
Ptprz1	A	G	6: 23,050,389		probably benign	Het
Rapgef3	C	A	15: 97,766,961	G7V	probably damaging	Het
Ripor1	T	A	8: 105,617,708	S491R	probably benign	Het
Rnf141	A	G	7: 110,821,365		probably benign	Het
Ryr3	C	T	2: 112,946,957	R285Q	probably damaging	Het
Sall4	T	C	2: 168,756,545	N125S	probably benign	Het
Schip1	A	G	3: 68,617,786	K360R	probably damaging	Het
Senp6	T	A	9: 80,089,869	V55E	probably benign	Het
Skint1	T	A	4: 112,025,533	V258D	probably benign	Het
Slc25a16	T	A	10: 62,932,751	H130Q	probably benign	Het
Styx	T	C	14: 45,373,563	V217A	probably benign	Het
Syne2	G	A	12: 75,888,342		probably null	Het
Tagap1	A	G	17: 6,956,860	S146P	probably benign	Het
Tatdn2	A	G	6: 113,704,142	K379E	probably benign	Het
Thrap3	T	C	4: 126,175,396	Y654C	possibly damaging	Het
Tle2	T	C	10: 81,580,551	L135P	probably damaging	Het
Tmc1	A	G	19: 20,824,309	F451S	possibly damaging	Het
Trpm7	G	A	2: 126,797,727	P1650S	probably damaging	Het
Ttll4	G	A	1: 74,680,382	R16H	possibly damaging	Het
Ttn	T	C	2: 76,714,373	N32795S	probably damaging	Het
Tubgcp6	T	C	15: 89,104,489	E803G	probably benign	Het
Ubr2	A	G	17: 46,963,145		probably null	Het
Ugt2b35	A	G	5: 87,001,553	D221G	probably damaging	Het
Unc45b	G	A	11: 82,911,689	A4T	probably benign	Het
Vmn1r70	A	T	7: 10,634,337	I251F	possibly damaging	Het
Vmn2r120	T	A	17: 57,524,553	H412L	possibly damaging	Het
Zfp59	A	G	7: 27,853,510	N129S	probably benign	Het
Zgrf1	T	C	3: 127,613,350	C1589R	probably damaging	Het

Other mutations in Nek1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Nek1	APN	8	61043284	missense	probably benign	0.00
IGL01075:Nek1	APN	8	61124132	missense	possibly damaging	0.64
IGL01122:Nek1	APN	8	61120966	missense	possibly damaging	0.80
IGL01151:Nek1	APN	8	61020077	missense	probably damaging	1.00
IGL01286:Nek1	APN	8	61124216	missense	possibly damaging	0.64
IGL01377:Nek1	APN	8	61089456	missense	probably benign
IGL01485:Nek1	APN	8	61049826	missense	probably benign	0.02
IGL01688:Nek1	APN	8	61105597	nonsense	probably null
IGL01806:Nek1	APN	8	61124212	missense	possibly damaging	0.82
IGL02006:Nek1	APN	8	61104192	missense	probably benign	0.20
IGL02304:Nek1	APN	8	61012167	missense	probably damaging	1.00
IGL02659:Nek1	APN	8	61089480	missense	probably benign	0.16
IGL02662:Nek1	APN	8	61104184	missense	probably benign	0.00
IGL02801:Nek1	APN	8	61121061	critical splice donor site	probably null
IGL02806:Nek1	APN	8	61044086	missense	probably benign	0.15
IGL03037:Nek1	APN	8	61034052	missense	probably benign	0.16
IGL03252:Nek1	APN	8	61072330	nonsense	probably null
P0014:Nek1	UTSW	8	61071747	splice site	probably benign
R0019:Nek1	UTSW	8	61089734	missense	probably benign	0.01
R0403:Nek1	UTSW	8	61106855	missense	probably damaging	0.99
R0464:Nek1	UTSW	8	61072273	splice site	probably benign
R0726:Nek1	UTSW	8	61089592	missense	probably damaging	1.00
R0761:Nek1	UTSW	8	61089455	missense	probably benign
R0827:Nek1	UTSW	8	61105648	splice site	probably benign
R0972:Nek1	UTSW	8	61089431	splice site	probably null
R1268:Nek1	UTSW	8	61022264	missense	probably damaging	1.00
R1343:Nek1	UTSW	8	61028675	missense	probably damaging	1.00
R1415:Nek1	UTSW	8	61089686	missense	probably benign	0.00
R1466:Nek1	UTSW	8	61125136	splice site	probably benign
R1480:Nek1	UTSW	8	61124326	splice site	probably null
R1526:Nek1	UTSW	8	61049941	missense	probably benign	0.26
R1552:Nek1	UTSW	8	61006737	missense	probably damaging	0.99
R1606:Nek1	UTSW	8	61124276	missense	possibly damaging	0.82
R1650:Nek1	UTSW	8	61036076	missense	probably benign	0.00
R1757:Nek1	UTSW	8	61089813	splice site	probably null
R1808:Nek1	UTSW	8	61016230	missense	probably damaging	1.00
R1966:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R2111:Nek1	UTSW	8	61124326	splice site	probably null
R2113:Nek1	UTSW	8	61016293	missense	probably damaging	1.00
R2143:Nek1	UTSW	8	61028696	missense	probably damaging	1.00
R2255:Nek1	UTSW	8	61089773	missense	probably damaging	1.00
R2422:Nek1	UTSW	8	61019901	missense	probably damaging	1.00
R3848:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3849:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3850:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R4418:Nek1	UTSW	8	61106864	missense	probably damaging	1.00
R4526:Nek1	UTSW	8	61106944	missense	probably damaging	0.99
R4533:Nek1	UTSW	8	61007213	missense	possibly damaging	0.95
R4544:Nek1	UTSW	8	61016304	nonsense	probably null
R4677:Nek1	UTSW	8	61028806	missense	probably damaging	0.99
R4739:Nek1	UTSW	8	61098511	missense	probably benign	0.32
R5068:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R5421:Nek1	UTSW	8	61006677	missense	possibly damaging	0.81
R5516:Nek1	UTSW	8	61089489	missense	probably benign	0.03
R5855:Nek1	UTSW	8	61016272	missense	probably damaging	1.00
R6125:Nek1	UTSW	8	61028701	missense	probably damaging	1.00
R6267:Nek1	UTSW	8	61072309	nonsense	probably null
R6292:Nek1	UTSW	8	61054736	splice site	probably null
R6296:Nek1	UTSW	8	61072309	nonsense	probably null
R6458:Nek1	UTSW	8	61100012	missense	probably benign	0.00
R6568:Nek1	UTSW	8	61106821	missense	probably benign	0.00
R6629:Nek1	UTSW	8	61054333	splice site	probably null
R6867:Nek1	UTSW	8	61072330	missense	possibly damaging	0.81
R7122:Nek1	UTSW	8	61106795	missense	probably benign	0.00
R7193:Nek1	UTSW	8	61073578	missense	probably damaging	0.99
R7272:Nek1	UTSW	8	61125086	missense	probably benign	0.34
R7356:Nek1	UTSW	8	61120960	missense	probably benign	0.02
R7368:Nek1	UTSW	8	61089707	missense	probably benign	0.24
R7478:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7479:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7512:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7715:Nek1	UTSW	8	61006760	missense	probably damaging	0.98
R7984:Nek1	UTSW	8	61121053	nonsense	probably null
R8271:Nek1	UTSW	8	61105612	missense	probably benign	0.04
R8431:Nek1	UTSW	8	61034032	missense	possibly damaging	0.95
RF023:Nek1	UTSW	8	61072745	splice site	probably null
X0028:Nek1	UTSW	8	61043258	missense	probably benign	0.19
X0066:Nek1	UTSW	8	61125128	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCACCCTAAAAGAGTTGCAC -3'
(R):5'- TCTGTCCTAGAATCAAACTGCCAC -3'

Sequencing Primer
(F):5'- AGAGTTGCACTTACACATTCACTTC -3'
(R):5'- CACAAAATAATTCCTTACAAGG -3'

Posted On

2014-09-17