Incidental Mutation 'R0148:Zfhx2'
ID22677
Institutional Source Beutler Lab
Gene Symbol Zfhx2
Ensembl Gene ENSMUSG00000040721
Gene Namezinc finger homeobox 2
Synonymszfh-5
MMRRC Submission 038432-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R0148 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location55060262-55092324 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55072897 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 731 (Y731H)
Ref Sequence ENSEMBL: ENSMUSP00000045156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036328] [ENSMUST00000183822] [ENSMUST00000185121]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036328
AA Change: Y731H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045156
Gene: ENSMUSG00000040721
AA Change: Y731H

DomainStartEndE-ValueType
low complexity region 22 42 N/A INTRINSIC
ZnF_C2H2 230 252 1.43e1 SMART
low complexity region 333 345 N/A INTRINSIC
low complexity region 428 439 N/A INTRINSIC
ZnF_C2H2 446 469 8.94e-3 SMART
ZnF_U1 498 532 6.98e-1 SMART
ZnF_C2H2 501 525 3.21e-4 SMART
ZnF_U1 560 594 1.36e0 SMART
ZnF_C2H2 563 587 3.29e-1 SMART
low complexity region 597 623 N/A INTRINSIC
ZnF_C2H2 752 776 6.4e0 SMART
ZnF_C2H2 815 839 2.02e-1 SMART
ZnF_U1 861 895 1.78e1 SMART
ZnF_C2H2 864 888 5.34e-1 SMART
ZnF_C2H2 974 997 1.51e1 SMART
ZnF_C2H2 1003 1026 1.51e0 SMART
low complexity region 1087 1103 N/A INTRINSIC
low complexity region 1106 1126 N/A INTRINSIC
ZnF_U1 1182 1216 3.42e0 SMART
ZnF_C2H2 1185 1209 8.22e-2 SMART
ZnF_U1 1239 1273 3.73e0 SMART
ZnF_C2H2 1242 1266 6.67e-2 SMART
low complexity region 1277 1304 N/A INTRINSIC
low complexity region 1314 1326 N/A INTRINSIC
low complexity region 1332 1346 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
low complexity region 1379 1400 N/A INTRINSIC
low complexity region 1457 1465 N/A INTRINSIC
ZnF_C2H2 1474 1497 5.34e0 SMART
low complexity region 1522 1531 N/A INTRINSIC
low complexity region 1542 1554 N/A INTRINSIC
low complexity region 1562 1583 N/A INTRINSIC
HOX 1589 1651 1.97e-16 SMART
low complexity region 1656 1665 N/A INTRINSIC
coiled coil region 1693 1723 N/A INTRINSIC
ZnF_C2H2 1761 1783 2.53e-2 SMART
low complexity region 1837 1847 N/A INTRINSIC
HOX 1851 1913 2.34e-18 SMART
low complexity region 1984 1995 N/A INTRINSIC
low complexity region 2001 2051 N/A INTRINSIC
HOX 2058 2120 1.52e-17 SMART
ZnF_U1 2136 2170 1.09e1 SMART
ZnF_C2H2 2139 2163 5.4e1 SMART
low complexity region 2328 2354 N/A INTRINSIC
low complexity region 2385 2426 N/A INTRINSIC
ZnF_U1 2482 2516 8.31e-1 SMART
ZnF_C2H2 2485 2509 9.46e0 SMART
low complexity region 2523 2538 N/A INTRINSIC
low complexity region 2553 2562 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176665
SMART Domains Protein: ENSMUSP00000134955
Gene: ENSMUSG00000040721

DomainStartEndE-ValueType
ZnF_C2H2 13 37 5.34e-1 SMART
ZnF_C2H2 133 156 1.51e1 SMART
ZnF_C2H2 162 185 1.51e0 SMART
low complexity region 246 262 N/A INTRINSIC
low complexity region 265 285 N/A INTRINSIC
ZnF_C2H2 344 368 8.22e-2 SMART
ZnF_C2H2 401 425 6.67e-2 SMART
low complexity region 436 463 N/A INTRINSIC
low complexity region 473 485 N/A INTRINSIC
low complexity region 491 505 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
low complexity region 538 559 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183822
SMART Domains Protein: ENSMUSP00000140371
Gene: ENSMUSG00000045691

DomainStartEndE-ValueType
PDB:2JMU|A 5 64 3e-23 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185430
Meta Mutation Damage Score 0.1250 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 86% (30/35)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,662,446 probably null Het
Agtr1a T C 13: 30,381,944 S331P probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Bahcc1 A T 11: 120,268,404 Q152H probably damaging Het
Bend3 T A 10: 43,511,950 Y780N probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Efl1 T C 7: 82,671,670 S104P probably damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fbln1 G A 15: 85,230,826 R193H probably damaging Het
Fbxw21 A G 9: 109,148,017 probably null Het
Fgf17 C T 14: 70,638,873 R49Q probably damaging Het
Flnb T C 14: 7,939,077 S2307P probably benign Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Git1 A G 11: 77,505,728 T601A probably benign Het
Gm10722 T "C,A" 9: 3,001,405 probably null Het
Gm5142 C T 14: 59,178,670 R13H possibly damaging Het
Gria2 A C 3: 80,707,731 W481G probably damaging Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Il4ra T A 7: 125,575,537 C306S probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Lama3 G A 18: 12,448,272 C596Y probably damaging Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
March6 C T 15: 31,490,612 V293M probably damaging Het
Med12l A G 3: 59,037,654 D100G probably damaging Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mrpl53 T C 6: 83,109,537 L74P probably damaging Het
Mvp C T 7: 126,989,865 V577M probably damaging Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nipsnap3b C T 4: 53,017,088 A104V possibly damaging Het
Nlrp14 A G 7: 107,182,721 Y375C probably benign Het
Nod1 A G 6: 54,938,217 Y764H probably damaging Het
Olfr225 G A 11: 59,613,494 V177M probably damaging Het
Olfr270 A T 4: 52,971,232 I204F probably benign Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Peg10 C A 6: 4,755,711 R96S possibly damaging Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rilp A T 11: 75,510,233 H29L probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Ryr1 C A 7: 29,052,035 R3706L probably damaging Het
Ryr2 T C 13: 11,714,548 D2396G probably damaging Het
Slc45a2 T C 15: 11,025,868 S435P probably damaging Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tep1 A T 14: 50,824,789 D2535E possibly damaging Het
Tkt T A 14: 30,572,220 I529N probably damaging Het
Trp53i11 T G 2: 93,197,735 V39G probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Usp3 A G 9: 66,540,167 V219A possibly damaging Het
Usp4 T A 9: 108,391,671 probably null Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Xkr6 T C 14: 63,819,549 V303A unknown Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Other mutations in Zfhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Zfhx2 APN 14 55066565 missense possibly damaging 0.93
IGL00164:Zfhx2 APN 14 55065026 missense possibly damaging 0.73
IGL00235:Zfhx2 APN 14 55063257 missense probably benign 0.11
IGL00925:Zfhx2 APN 14 55073061 missense probably benign 0.06
IGL01025:Zfhx2 APN 14 55064260 missense probably damaging 1.00
IGL01061:Zfhx2 APN 14 55073882 missense possibly damaging 0.96
IGL01486:Zfhx2 APN 14 55067090 missense probably damaging 1.00
IGL01875:Zfhx2 APN 14 55063915 missense unknown
IGL01990:Zfhx2 APN 14 55073590 missense probably damaging 0.99
IGL02097:Zfhx2 APN 14 55062894 missense probably damaging 1.00
IGL02269:Zfhx2 APN 14 55071936 missense probably benign 0.00
IGL02488:Zfhx2 APN 14 55065103 missense possibly damaging 0.72
IGL02624:Zfhx2 APN 14 55066628 missense probably benign 0.06
IGL03087:Zfhx2 APN 14 55072845 missense possibly damaging 0.85
PIT4403001:Zfhx2 UTSW 14 55074980 missense probably benign
R0323:Zfhx2 UTSW 14 55065979 missense possibly damaging 0.73
R0328:Zfhx2 UTSW 14 55071988 missense probably benign
R0348:Zfhx2 UTSW 14 55063508 missense probably damaging 0.99
R0442:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
R0533:Zfhx2 UTSW 14 55064090 missense probably benign 0.23
R0561:Zfhx2 UTSW 14 55065889 missense probably benign 0.01
R0627:Zfhx2 UTSW 14 55065327 missense probably benign
R0659:Zfhx2 UTSW 14 55073801 missense possibly damaging 0.73
R0675:Zfhx2 UTSW 14 55063163 missense probably damaging 0.99
R1301:Zfhx2 UTSW 14 55063397 missense probably benign 0.32
R1563:Zfhx2 UTSW 14 55065088 missense probably benign 0.33
R1607:Zfhx2 UTSW 14 55062985 missense probably damaging 1.00
R1694:Zfhx2 UTSW 14 55073944 missense possibly damaging 0.91
R1710:Zfhx2 UTSW 14 55065998 missense possibly damaging 0.70
R1773:Zfhx2 UTSW 14 55072891 missense possibly damaging 0.53
R1879:Zfhx2 UTSW 14 55065617 missense probably benign 0.32
R1879:Zfhx2 UTSW 14 55072749 missense possibly damaging 0.96
R1933:Zfhx2 UTSW 14 55075238 start gained probably benign
R1944:Zfhx2 UTSW 14 55074732 missense probably benign 0.18
R2888:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2889:Zfhx2 UTSW 14 55064803 missense possibly damaging 0.71
R2915:Zfhx2 UTSW 14 55064557 missense probably damaging 0.98
R3971:Zfhx2 UTSW 14 55074475 missense probably benign 0.33
R4082:Zfhx2 UTSW 14 55065205 missense probably benign
R4134:Zfhx2 UTSW 14 55065143 missense possibly damaging 0.93
R4231:Zfhx2 UTSW 14 55073534 missense possibly damaging 0.73
R4675:Zfhx2 UTSW 14 55067221 missense probably benign 0.03
R4764:Zfhx2 UTSW 14 55066915 missense possibly damaging 0.96
R4866:Zfhx2 UTSW 14 55065536 missense possibly damaging 0.73
R4940:Zfhx2 UTSW 14 55066434 missense possibly damaging 0.53
R5125:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5178:Zfhx2 UTSW 14 55074775 missense probably benign 0.00
R5554:Zfhx2 UTSW 14 55064317 missense probably damaging 1.00
R5689:Zfhx2 UTSW 14 55073903 missense possibly damaging 0.53
R5768:Zfhx2 UTSW 14 55074365 missense probably benign
R5792:Zfhx2 UTSW 14 55066846 missense possibly damaging 0.72
R5834:Zfhx2 UTSW 14 55073330 nonsense probably null
R5895:Zfhx2 UTSW 14 55065891 missense probably benign
R5999:Zfhx2 UTSW 14 55074005 missense probably benign
R6025:Zfhx2 UTSW 14 55065208 missense probably benign 0.00
R6106:Zfhx2 UTSW 14 55068310 critical splice acceptor site probably null
R6135:Zfhx2 UTSW 14 55074196 missense possibly damaging 0.85
R6186:Zfhx2 UTSW 14 55063160 missense probably damaging 0.99
R6379:Zfhx2 UTSW 14 55074338 missense probably benign
R6725:Zfhx2 UTSW 14 55064082 nonsense probably null
R7089:Zfhx2 UTSW 14 55065772 missense probably benign 0.33
R7383:Zfhx2 UTSW 14 55068253 missense probably benign 0.00
R7470:Zfhx2 UTSW 14 55066750 missense possibly damaging 0.52
R7606:Zfhx2 UTSW 14 55066663 missense probably benign 0.12
R7607:Zfhx2 UTSW 14 55066231 missense possibly damaging 0.86
R7698:Zfhx2 UTSW 14 55062849 missense probably benign 0.00
R7730:Zfhx2 UTSW 14 55066900 missense possibly damaging 0.53
X0065:Zfhx2 UTSW 14 55066960 missense probably benign 0.33
Z1088:Zfhx2 UTSW 14 55074180 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGGACTCGAAGTCACAGATGTTGC -3'
(R):5'- ACACAGCTTATCCTAAGTGCCCCG -3'

Sequencing Primer
(F):5'- TGGAGCCGTAAGAAGCCC -3'
(R):5'- AAGTGCCCCGCTCATTTC -3'
Posted On2013-04-16