Incidental Mutation 'R2067:Tubgcp6'
ID226792
Institutional Source Beutler Lab
Gene Symbol Tubgcp6
Ensembl Gene ENSMUSG00000051786
Gene Nametubulin, gamma complex associated protein 6
Synonyms
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R2067 (G1)
Quality Score216
Status Validated
Chromosome15
Chromosomal Location89098357-89123112 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89104489 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 803 (E803G)
Ref Sequence ENSEMBL: ENSMUSP00000104977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000166480]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
AA Change: E795G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786
AA Change: E795G

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082439
SMART Domains Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 79 625 8.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109353
AA Change: E803G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786
AA Change: E803G

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163290
SMART Domains Protein: ENSMUSP00000131359
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 91 288 2.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164717
Predicted Effect probably benign
Transcript: ENSMUST00000166480
SMART Domains Protein: ENSMUSP00000132108
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 2 123 5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168256
Predicted Effect probably benign
Transcript: ENSMUST00000169069
SMART Domains Protein: ENSMUSP00000132786
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
coiled coil region 77 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169208
Predicted Effect probably benign
Transcript: ENSMUST00000170877
Meta Mutation Damage Score 0.2083 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Espl1 T C 15: 102,299,090 S330P probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Rapgef3 C A 15: 97,766,961 G7V probably damaging Het
Ripor1 T A 8: 105,617,708 S491R probably benign Het
Rnf141 A G 7: 110,821,365 probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Sall4 T C 2: 168,756,545 N125S probably benign Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b35 A G 5: 87,001,553 D221G probably damaging Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Tubgcp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tubgcp6 APN 15 89104008 missense probably benign 0.00
IGL00556:Tubgcp6 APN 15 89100962 missense probably damaging 1.00
IGL00943:Tubgcp6 APN 15 89122397 nonsense probably null
IGL01284:Tubgcp6 APN 15 89110055 missense probably damaging 1.00
IGL01363:Tubgcp6 APN 15 89107525 missense probably damaging 1.00
IGL01386:Tubgcp6 APN 15 89107996 nonsense probably null
IGL01792:Tubgcp6 APN 15 89101281 missense probably damaging 1.00
IGL01866:Tubgcp6 APN 15 89103488 missense probably benign 0.01
IGL02596:Tubgcp6 APN 15 89100914 missense probably damaging 1.00
IGL02858:Tubgcp6 APN 15 89102315 nonsense probably null
IGL02873:Tubgcp6 APN 15 89103824 missense probably benign 0.00
IGL03400:Tubgcp6 APN 15 89108099 unclassified probably benign
IGL02796:Tubgcp6 UTSW 15 89122390 missense probably benign 0.03
R0010:Tubgcp6 UTSW 15 89103183 missense probably benign 0.00
R0308:Tubgcp6 UTSW 15 89122436 missense possibly damaging 0.85
R0440:Tubgcp6 UTSW 15 89103065 missense probably benign 0.12
R0631:Tubgcp6 UTSW 15 89100987 missense probably damaging 1.00
R1653:Tubgcp6 UTSW 15 89107442 missense probably damaging 1.00
R1901:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1902:Tubgcp6 UTSW 15 89116241 missense possibly damaging 0.68
R1905:Tubgcp6 UTSW 15 89100608 missense probably damaging 1.00
R2005:Tubgcp6 UTSW 15 89104166 missense probably benign 0.01
R2083:Tubgcp6 UTSW 15 89122376 missense probably damaging 1.00
R2285:Tubgcp6 UTSW 15 89122474 missense probably damaging 1.00
R2401:Tubgcp6 UTSW 15 89102984 missense probably benign 0.22
R2436:Tubgcp6 UTSW 15 89102365 missense probably benign 0.37
R3017:Tubgcp6 UTSW 15 89103082 nonsense probably null
R3054:Tubgcp6 UTSW 15 89122603 missense probably damaging 1.00
R3932:Tubgcp6 UTSW 15 89104414 unclassified probably benign
R4350:Tubgcp6 UTSW 15 89103995 missense probably benign 0.00
R4472:Tubgcp6 UTSW 15 89103654 missense probably damaging 0.98
R4864:Tubgcp6 UTSW 15 89103818 missense probably benign
R4937:Tubgcp6 UTSW 15 89101549 missense probably damaging 0.98
R4983:Tubgcp6 UTSW 15 89106291 missense probably damaging 1.00
R4996:Tubgcp6 UTSW 15 89103490 missense possibly damaging 0.89
R5044:Tubgcp6 UTSW 15 89099545 unclassified probably benign
R5122:Tubgcp6 UTSW 15 89116103 missense probably damaging 1.00
R5607:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5608:Tubgcp6 UTSW 15 89111150 missense probably benign 0.02
R5653:Tubgcp6 UTSW 15 89108612 missense possibly damaging 0.47
R5886:Tubgcp6 UTSW 15 89103247 missense possibly damaging 0.82
R5945:Tubgcp6 UTSW 15 89109217 splice site probably null
R6111:Tubgcp6 UTSW 15 89100920 missense possibly damaging 0.83
R6195:Tubgcp6 UTSW 15 89122791 missense probably benign 0.01
R6792:Tubgcp6 UTSW 15 89122877 start gained probably benign
R7074:Tubgcp6 UTSW 15 89120636 missense probably damaging 1.00
R7103:Tubgcp6 UTSW 15 89101029 missense probably damaging 0.96
R7274:Tubgcp6 UTSW 15 89102970 nonsense probably null
R7275:Tubgcp6 UTSW 15 89102943 nonsense probably null
R7514:Tubgcp6 UTSW 15 89120525 missense probably damaging 1.00
R7540:Tubgcp6 UTSW 15 89102323 missense possibly damaging 0.48
R7571:Tubgcp6 UTSW 15 89100722 missense probably damaging 1.00
R7706:Tubgcp6 UTSW 15 89104223 missense probably benign
R7721:Tubgcp6 UTSW 15 89101401 missense probably damaging 1.00
R7996:Tubgcp6 UTSW 15 89109028 missense possibly damaging 0.92
R8095:Tubgcp6 UTSW 15 89122774 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAGGACCTGTAGATGTGACCTG -3'
(R):5'- CCTGTTGCATAAGGGGACAG -3'

Sequencing Primer
(F):5'- GACCTGTAGATGTGACCTGAAACAC -3'
(R):5'- GGACAGATGGCACTTGCTG -3'
Posted On2014-09-17