Incidental Mutation 'R2067:Rapgef3'
ID226793
Institutional Source Beutler Lab
Gene Symbol Rapgef3
Ensembl Gene ENSMUSG00000022469
Gene NameRap guanine nucleotide exchange factor (GEF) 3
Synonyms2310016P22Rik, 9330170P05Rik, Epac1
MMRRC Submission 040072-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R2067 (G1)
Quality Score173
Status Validated
Chromosome15
Chromosomal Location97744770-97767972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 97766961 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 7 (G7V)
Ref Sequence ENSEMBL: ENSMUSP00000117337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126854] [ENSMUST00000128775] [ENSMUST00000129223] [ENSMUST00000134885] [ENSMUST00000135080] [ENSMUST00000146620] [ENSMUST00000149419] [ENSMUST00000175894] [ENSMUST00000177352]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123397
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124374
Predicted Effect probably damaging
Transcript: ENSMUST00000126854
AA Change: G7V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116426
Gene: ENSMUSG00000022469
AA Change: G7V

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 926 7.98e-95 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128775
AA Change: G7V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120126
Gene: ENSMUSG00000022469
AA Change: G7V

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 7e-45 BLAST
RasGEF 661 909 5.53e-80 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129223
AA Change: G7V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118148
Gene: ENSMUSG00000022469
AA Change: G7V

DomainStartEndE-ValueType
DEP 111 186 2.05e-25 SMART
low complexity region 197 208 N/A INTRINSIC
low complexity region 230 241 N/A INTRINSIC
cNMP 245 364 2.53e-12 SMART
RasGEFN 383 514 7.04e-10 SMART
Blast:RasGEF 547 644 6e-45 BLAST
RasGEF 661 918 2.11e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134885
SMART Domains Protein: ENSMUSP00000135317
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
RasGEF 1 216 2.91e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135080
AA Change: G7V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000146620
SMART Domains Protein: ENSMUSP00000116673
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
DEP 69 144 2.05e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149373
Predicted Effect probably benign
Transcript: ENSMUST00000149419
Predicted Effect probably damaging
Transcript: ENSMUST00000175894
AA Change: G7V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000177352
SMART Domains Protein: ENSMUSP00000135238
Gene: ENSMUSG00000022469

DomainStartEndE-ValueType
DEP 69 144 2.05e-25 SMART
low complexity region 155 166 N/A INTRINSIC
low complexity region 188 199 N/A INTRINSIC
cNMP 203 322 2.53e-12 SMART
RasGEFN 341 472 7.04e-10 SMART
Blast:RasGEF 505 602 3e-45 BLAST
RasGEF 619 884 7.98e-95 SMART
Meta Mutation Damage Score 0.2800 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 97% (76/78)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased induced neuron apoptosis. Mice homozygous for a different allele exhibit impaired glucose homeostasis with decreased insulin secretion, increased susceptibility to diet-induced obesity and streptozotocin-induced insulitis and hyperglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530002B09Rik T A 4: 122,689,322 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Acin1 T A 14: 54,665,254 Q360H probably damaging Het
Aldh3b1 T A 19: 3,921,755 D72V probably benign Het
Alox12e G A 11: 70,316,002 R620W probably damaging Het
Alpl T C 4: 137,749,545 probably benign Het
Amy2a1 T C 3: 113,530,568 I108V probably benign Het
Ascc2 A T 11: 4,681,496 M646L probably benign Het
Bod1l G A 5: 41,817,086 T2295M probably benign Het
Ccdc9 A T 7: 16,278,550 probably null Het
Clptm1l C T 13: 73,607,723 Q153* probably null Het
Csmd1 A G 8: 15,900,782 S3476P probably benign Het
Ddias A T 7: 92,859,699 M336K possibly damaging Het
Ehd1 T C 19: 6,298,078 L362P probably benign Het
Epha1 G T 6: 42,366,053 H187Q probably benign Het
Espl1 T C 15: 102,299,090 S330P probably damaging Het
Fbln7 G T 2: 128,877,466 R61L probably damaging Het
Fbxo41 C T 6: 85,478,471 W577* probably null Het
Fgb C A 3: 83,049,689 D25Y probably benign Het
Gc T A 5: 89,446,517 K37N probably damaging Het
Gfpt1 T C 6: 87,057,754 I178T probably benign Het
Gm12695 T C 4: 96,769,726 T69A probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm9912 T C 3: 149,185,159 T113A unknown Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Htt C T 5: 34,825,982 T975I probably benign Het
Itpr3 G A 17: 27,098,076 M768I probably benign Het
Krt4 C A 15: 101,924,664 A3S possibly damaging Het
Mrto4 T C 4: 139,349,023 K86E probably benign Het
Mup4 T A 4: 59,960,622 probably benign Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Myo1a A G 10: 127,705,478 N43D probably benign Het
Napa A T 7: 16,115,278 probably benign Het
Ndufa12 A G 10: 94,220,707 D99G probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T C 8: 61,007,162 S41P probably damaging Het
Nolc1 C T 19: 46,083,607 T612M probably damaging Het
Nsun5 T G 5: 135,375,072 Y301D probably damaging Het
Oas1g T C 5: 120,885,883 E121G probably damaging Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr324 A G 11: 58,597,570 N58S probably damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr522 T A 7: 140,162,909 I14F possibly damaging Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Osmr T C 15: 6,815,415 N957D probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Phc2 T C 4: 128,747,136 F672S probably damaging Het
Pik3c2b T C 1: 133,099,611 S1283P probably damaging Het
Pole2 G A 12: 69,228,152 R5W probably benign Het
Prl7a2 T A 13: 27,660,887 Y172F probably damaging Het
Ptprz1 A G 6: 23,050,389 probably benign Het
Ripor1 T A 8: 105,617,708 S491R probably benign Het
Rnf141 A G 7: 110,821,365 probably benign Het
Ryr3 C T 2: 112,946,957 R285Q probably damaging Het
Sall4 T C 2: 168,756,545 N125S probably benign Het
Schip1 A G 3: 68,617,786 K360R probably damaging Het
Senp6 T A 9: 80,089,869 V55E probably benign Het
Skint1 T A 4: 112,025,533 V258D probably benign Het
Slc25a16 T A 10: 62,932,751 H130Q probably benign Het
Styx T C 14: 45,373,563 V217A probably benign Het
Syne2 G A 12: 75,888,342 probably null Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tatdn2 A G 6: 113,704,142 K379E probably benign Het
Thrap3 T C 4: 126,175,396 Y654C possibly damaging Het
Tle2 T C 10: 81,580,551 L135P probably damaging Het
Tmc1 A G 19: 20,824,309 F451S possibly damaging Het
Trpm7 G A 2: 126,797,727 P1650S probably damaging Het
Ttll4 G A 1: 74,680,382 R16H possibly damaging Het
Ttn T C 2: 76,714,373 N32795S probably damaging Het
Tubgcp6 T C 15: 89,104,489 E803G probably benign Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b35 A G 5: 87,001,553 D221G probably damaging Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Vmn1r70 A T 7: 10,634,337 I251F possibly damaging Het
Vmn2r120 T A 17: 57,524,553 H412L possibly damaging Het
Zfp59 A G 7: 27,853,510 N129S probably benign Het
Zgrf1 T C 3: 127,613,350 C1589R probably damaging Het
Other mutations in Rapgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Rapgef3 APN 15 97748223 missense probably damaging 1.00
IGL01339:Rapgef3 APN 15 97758059 missense probably damaging 1.00
IGL01670:Rapgef3 APN 15 97749662 missense probably benign 0.15
IGL01902:Rapgef3 APN 15 97750300 missense probably benign 0.32
IGL02137:Rapgef3 APN 15 97750144 missense probably benign 0.08
IGL02419:Rapgef3 APN 15 97750290 missense probably benign 0.33
IGL02427:Rapgef3 APN 15 97747136 splice site probably null
IGL02648:Rapgef3 APN 15 97758392 missense probably damaging 1.00
IGL02834:Rapgef3 APN 15 97748265 missense probably damaging 0.98
IGL03389:Rapgef3 APN 15 97749516 missense probably damaging 1.00
IGL03055:Rapgef3 UTSW 15 97749489 splice site probably benign
R0394:Rapgef3 UTSW 15 97757819 intron probably benign
R0538:Rapgef3 UTSW 15 97757817 intron probably benign
R0744:Rapgef3 UTSW 15 97761585 splice site probably benign
R1288:Rapgef3 UTSW 15 97759342 missense probably benign 0.31
R1512:Rapgef3 UTSW 15 97757501 missense probably benign 0.24
R1676:Rapgef3 UTSW 15 97761182 missense probably benign 0.35
R1745:Rapgef3 UTSW 15 97750178 missense probably benign 0.22
R1928:Rapgef3 UTSW 15 97750033 missense probably damaging 1.00
R2063:Rapgef3 UTSW 15 97766961 missense probably damaging 1.00
R2092:Rapgef3 UTSW 15 97760723 missense probably damaging 1.00
R4358:Rapgef3 UTSW 15 97748648 missense probably benign 0.05
R4624:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4627:Rapgef3 UTSW 15 97758929 missense probably damaging 1.00
R4727:Rapgef3 UTSW 15 97760600 missense probably damaging 1.00
R4812:Rapgef3 UTSW 15 97753803 missense probably benign 0.21
R4928:Rapgef3 UTSW 15 97757375 missense probably damaging 1.00
R5161:Rapgef3 UTSW 15 97757725 missense probably damaging 1.00
R5442:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R5652:Rapgef3 UTSW 15 97758437 missense probably benign 0.00
R5837:Rapgef3 UTSW 15 97757342 splice site probably benign
R6056:Rapgef3 UTSW 15 97758861 missense probably damaging 0.99
R6167:Rapgef3 UTSW 15 97767411 unclassified probably benign
R6694:Rapgef3 UTSW 15 97759984 missense probably benign 0.03
R7039:Rapgef3 UTSW 15 97761568 missense probably benign 0.01
R7154:Rapgef3 UTSW 15 97753877 missense probably benign
R7380:Rapgef3 UTSW 15 97766791 missense probably benign 0.00
R7655:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7656:Rapgef3 UTSW 15 97761209 missense probably damaging 1.00
R7754:Rapgef3 UTSW 15 97757746 missense probably damaging 1.00
R7849:Rapgef3 UTSW 15 97758390 critical splice donor site probably null
R8061:Rapgef3 UTSW 15 97761520 missense probably benign
R8117:Rapgef3 UTSW 15 97750866 missense probably benign 0.01
R8179:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
RF024:Rapgef3 UTSW 15 97760740 missense probably benign 0.06
X0011:Rapgef3 UTSW 15 97761473 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTGCTCTGGAGAAAGCTGCC -3'
(R):5'- AGTTGAGTGGAGACCCCTAG -3'

Sequencing Primer
(F):5'- AGTCCCTGGATGCAGCTG -3'
(R):5'- CCCCTAGGTGCGCCAAG -3'
Posted On2014-09-17