Incidental Mutation 'R0148:Fgf17'
ID22680
Institutional Source Beutler Lab
Gene Symbol Fgf17
Ensembl Gene ENSMUSG00000022101
Gene Namefibroblast growth factor 17
Synonyms
MMRRC Submission 038432-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R0148 (G1)
Quality Score225
Status Validated (trace)
Chromosome14
Chromosomal Location70636203-70642268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70638873 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 49 (R49Q)
Ref Sequence ENSEMBL: ENSMUSP00000154684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022695] [ENSMUST00000022697] [ENSMUST00000227123] [ENSMUST00000228295]
Predicted Effect probably benign
Transcript: ENSMUST00000022695
SMART Domains Protein: ENSMUSP00000022695
Gene: ENSMUSG00000022099

DomainStartEndE-ValueType
low complexity region 60 72 N/A INTRINSIC
low complexity region 88 99 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
coiled coil region 188 220 N/A INTRINSIC
low complexity region 252 267 N/A INTRINSIC
VHP 345 380 1.88e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022697
AA Change: R60Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022697
Gene: ENSMUSG00000022101
AA Change: R60Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FGF 51 178 1.66e-41 SMART
low complexity region 203 211 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000227123
AA Change: R49Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000228295
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 86% (30/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the fibroblast growth factor (FGF) family. Member of the FGF family possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein is expressed during embryogenesis and in the adult cerebellum and cortex and may be essential for vascular growth and normal brain development. Mutations in this gene are the cause of hypogonadotropic hypogonadism 20 with or without anosmia. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene are grossly normal at birth and apparently healthy at birth. However, there are tissue losses in the inferior colliculus and the anterior vermis of the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,662,446 probably null Het
Agtr1a T C 13: 30,381,944 S331P probably benign Het
Ank1 T A 8: 23,123,977 N1545K probably damaging Het
Bahcc1 A T 11: 120,268,404 Q152H probably damaging Het
Bend3 T A 10: 43,511,950 Y780N probably damaging Het
Bod1l G T 5: 41,818,697 A1758E possibly damaging Het
Ctcfl T C 2: 173,118,547 D81G possibly damaging Het
Ddx39 C T 8: 83,722,476 R298C possibly damaging Het
Dock8 T C 19: 25,119,459 L577P probably benign Het
Drc1 A T 5: 30,281,489 N13I possibly damaging Het
Efl1 T C 7: 82,671,670 S104P probably damaging Het
Eml4 T A 17: 83,421,652 N85K probably damaging Het
Epb41l4a T C 18: 33,798,800 T581A probably damaging Het
Epha3 T C 16: 63,612,944 D446G possibly damaging Het
Fam209 G T 2: 172,473,980 G92C probably damaging Het
Fbln1 G A 15: 85,230,826 R193H probably damaging Het
Fbxw21 A G 9: 109,148,017 probably null Het
Flnb T C 14: 7,939,077 S2307P probably benign Het
Galr1 A G 18: 82,405,570 L194P probably benign Het
Gar1 T C 3: 129,829,473 H89R probably damaging Het
Gbp4 T A 5: 105,119,496 Y519F probably benign Het
Git1 A G 11: 77,505,728 T601A probably benign Het
Gm10722 T "C,A" 9: 3,001,405 probably null Het
Gm5142 C T 14: 59,178,670 R13H possibly damaging Het
Gria2 A C 3: 80,707,731 W481G probably damaging Het
Homer2 T C 7: 81,624,278 T57A probably benign Het
Hpse2 A C 19: 42,931,660 probably null Het
Hspb7 T C 4: 141,423,991 I148T probably damaging Het
Htr1d C A 4: 136,443,477 T339K probably damaging Het
Il4ra T A 7: 125,575,537 C306S probably damaging Het
Kansl3 A T 1: 36,353,816 C225S probably damaging Het
Lama3 G A 18: 12,448,272 C596Y probably damaging Het
Lama5 T C 2: 180,190,406 H1714R probably benign Het
March6 C T 15: 31,490,612 V293M probably damaging Het
Med12l A G 3: 59,037,654 D100G probably damaging Het
Mettl14 G A 3: 123,371,394 T316I probably damaging Het
Mmp15 A T 8: 95,372,317 N591Y probably benign Het
Mrpl53 T C 6: 83,109,537 L74P probably damaging Het
Mvp C T 7: 126,989,865 V577M probably damaging Het
Neb T C 2: 52,249,376 K140E probably damaging Het
Nfya A G 17: 48,398,998 V48A possibly damaging Het
Ngf G T 3: 102,509,803 probably benign Het
Nipsnap3b C T 4: 53,017,088 A104V possibly damaging Het
Nlrp14 A G 7: 107,182,721 Y375C probably benign Het
Nod1 A G 6: 54,938,217 Y764H probably damaging Het
Olfr225 G A 11: 59,613,494 V177M probably damaging Het
Olfr270 A T 4: 52,971,232 I204F probably benign Het
Olfr873 T G 9: 20,301,091 M297R probably damaging Het
Pcdhb19 A T 18: 37,497,182 Q10L probably benign Het
Pdcl T C 2: 37,352,130 I203V probably benign Het
Peg10 C A 6: 4,755,711 R96S possibly damaging Het
Pknox1 T A 17: 31,604,790 N379K probably benign Het
Prodh T G 16: 18,077,813 Q360P probably damaging Het
Raf1 C T 6: 115,632,973 G202S probably benign Het
Rgs11 T A 17: 26,207,459 probably null Het
Rilp A T 11: 75,510,233 H29L probably damaging Het
Rtel1 T C 2: 181,321,046 C31R probably damaging Het
Rubcnl T A 14: 75,042,458 I427K probably damaging Het
Ryr1 C A 7: 29,052,035 R3706L probably damaging Het
Ryr2 T C 13: 11,714,548 D2396G probably damaging Het
Slc45a2 T C 15: 11,025,868 S435P probably damaging Het
Spata17 A G 1: 187,112,601 V111A probably damaging Het
Svep1 C T 4: 58,116,608 D881N possibly damaging Het
Sypl2 T A 3: 108,219,095 N67I possibly damaging Het
Tenm3 T C 8: 48,236,720 Y1944C probably damaging Het
Tep1 A T 14: 50,824,789 D2535E possibly damaging Het
Tkt T A 14: 30,572,220 I529N probably damaging Het
Trp53i11 T G 2: 93,197,735 V39G probably damaging Het
Trpm2 C T 10: 77,925,825 G997D probably damaging Het
Usp3 A G 9: 66,540,167 V219A possibly damaging Het
Usp4 T A 9: 108,391,671 probably null Het
Wdfy3 A G 5: 101,917,411 V1297A probably benign Het
Wdr46 T A 17: 33,941,023 F70I probably benign Het
Xkr6 T C 14: 63,819,549 V303A unknown Het
Zdbf2 C T 1: 63,304,006 Q515* probably null Het
Zfhx2 A G 14: 55,072,897 Y731H possibly damaging Het
Other mutations in Fgf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Fgf17 APN 14 70636980 missense probably damaging 1.00
IGL02319:Fgf17 APN 14 70636743 missense possibly damaging 0.92
IGL02519:Fgf17 APN 14 70638528 missense probably damaging 0.99
IGL02563:Fgf17 APN 14 70636738 nonsense probably null
R0487:Fgf17 UTSW 14 70638556 missense probably damaging 1.00
R1386:Fgf17 UTSW 14 70636770 missense probably damaging 0.96
R2130:Fgf17 UTSW 14 70638487 missense probably damaging 0.98
R2133:Fgf17 UTSW 14 70638487 missense probably damaging 0.98
R4033:Fgf17 UTSW 14 70641526 splice site probably benign
R4255:Fgf17 UTSW 14 70641722 critical splice donor site probably null
R5503:Fgf17 UTSW 14 70636968 missense probably damaging 1.00
R6924:Fgf17 UTSW 14 70641541 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCGAATGTATCTGTCTCCACGATG -3'
(R):5'- GTTTTCAGCTTGCACCGCACAC -3'

Sequencing Primer
(F):5'- AAAGAGACCTTAGTCTGTGGCTC -3'
(R):5'- GCCAGCCCCACTTCACTTAG -3'
Posted On2013-04-16