Mutagenetix > Incidental Mutation

Incidental Mutation 'R2068:Cdh20'

226809

Institutional Source

Beutler Lab

Gene Symbol

Cdh20

Ensembl Gene

ENSMUSG00000050840

Gene Name

cadherin 20

Synonyms

Cdh7

MMRRC Submission

040073-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.302) question?

Stock #

R2068 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104696254-104923206 bp(+) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 110065666 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 647 (R647*)

Ref Sequence

ENSEMBL: ENSMUSP00000129715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]

AlphaFold

Q9Z0M3

Predicted Effect

probably null
Transcript: ENSMUST00000027542
AA Change: R647*

SMART Domains

Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: R647*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	633	778	6e-54	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000112701
AA Change: R647*

SMART Domains

Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: R647*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000131464

SMART Domains

Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
PDB:1ZVN\|B	49	70	1e-9	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000134301

SMART Domains

Protein: ENSMUSP00000123394
Gene: ENSMUSG00000026312

Domain	Start	End	E-Value	Type
CA	24	111	2.26e-9	SMART
transmembrane domain	125	147	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000172005
AA Change: R647*

SMART Domains

Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: R647*

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
CA	70	151	5.77e-16	SMART
CA	175	260	2.9e-30	SMART
CA	284	376	1.96e-18	SMART
CA	399	480	1.19e-26	SMART
CA	503	590	2.26e-9	SMART
transmembrane domain	606	628	N/A	INTRINSIC
Pfam:Cadherin_C	631	779	4e-58	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a type II classical cadherin from the cadherin superfamily and one of three cadherin 7-like genes located in a cluster on chromosome 18. The encoded membrane protein is a calcium dependent cell-cell adhesion glycoprotein comprised of five extracellular cadherin repeats, a transmembrane region and a highly conserved cytoplasmic tail. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I cadherins. Since disturbance of intracellular adhesion is a prerequisite for invasion and metastasis of tumor cells, cadherins are considered prime candidates for tumor suppressor genes. [provided by RefSeq, Jul 2008]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933436I01Rik	T	A	X: 66,964,308 (GRCm39)	I184L	probably benign	Het
Abcb5	A	T	12: 118,904,303 (GRCm39)	C162*	probably null	Het
Akr1c19	A	T	13: 4,288,391 (GRCm39)		probably null	Het
Akt3	A	G	1: 176,930,551 (GRCm39)	S136P	possibly damaging	Het
Alox12e	G	A	11: 70,206,828 (GRCm39)	R620W	probably damaging	Het
Ascc2	A	T	11: 4,631,496 (GRCm39)	M646L	probably benign	Het
Bsn	T	G	9: 107,987,883 (GRCm39)		probably benign	Het
Bsn	T	A	9: 108,003,749 (GRCm39)	M219L	possibly damaging	Het
Btnl9	T	C	11: 49,060,390 (GRCm39)	T453A	probably damaging	Het
C6	G	T	15: 4,820,552 (GRCm39)	C521F	probably damaging	Het
Ccnt1	A	T	15: 98,449,823 (GRCm39)	H156Q	probably benign	Het
Clptm1l	C	T	13: 73,755,842 (GRCm39)	Q153*	probably null	Het
Cmya5	T	A	13: 93,227,032 (GRCm39)	K2685N	possibly damaging	Het
Cnksr2	A	C	X: 156,728,302 (GRCm39)	S224R	possibly damaging	Het
Cntn1	T	C	15: 92,215,943 (GRCm39)	V992A	possibly damaging	Het
Dapk1	G	A	13: 60,899,022 (GRCm39)	D831N	probably damaging	Het
Dnaaf3	T	C	7: 4,526,798 (GRCm39)	I426M	possibly damaging	Het
Dnah6	A	G	6: 72,998,165 (GRCm39)	Y4034H	probably benign	Het
Dtx2	C	T	5: 136,059,431 (GRCm39)	S493F	probably damaging	Het
Ehd1	T	C	19: 6,348,108 (GRCm39)	L362P	probably benign	Het
Endov	T	C	11: 119,390,408 (GRCm39)	F12S	probably damaging	Het
Eps8	A	T	6: 137,499,172 (GRCm39)	W239R	probably benign	Het
Fance	T	C	17: 28,539,799 (GRCm39)	F83S	possibly damaging	Het
Fn1	A	G	1: 71,639,598 (GRCm39)	V1731A	probably damaging	Het
Gak	G	T	5: 108,718,091 (GRCm39)	T1244K	probably benign	Het
Gas8	T	A	8: 124,253,276 (GRCm39)	I208N	probably damaging	Het
Gm9830	A	T	9: 44,375,579 (GRCm39)		noncoding transcript	Het
Gm9837	T	A	11: 53,361,092 (GRCm39)		probably benign	Het
Gtf2f2	A	G	14: 76,155,136 (GRCm39)	S142P	possibly damaging	Het
Hdac3	C	A	18: 38,076,569 (GRCm39)	G257V	probably damaging	Het
Heg1	A	G	16: 33,547,960 (GRCm39)	T916A	probably benign	Het
Herc2	G	T	7: 55,782,245 (GRCm39)	G1311C	probably damaging	Het
Htt	C	T	5: 34,983,326 (GRCm39)	T975I	probably benign	Het
Il2rg	A	G	X: 100,311,416 (GRCm39)	L57P	possibly damaging	Het
Itm2b	T	C	14: 73,600,575 (GRCm39)	K242E	probably damaging	Het
Itpr3	G	A	17: 27,317,050 (GRCm39)	M768I	probably benign	Het
Klrg2	G	A	6: 38,613,928 (GRCm39)	T25I	probably benign	Het
Lcn5	G	A	2: 25,548,053 (GRCm39)	V21M	probably damaging	Het
Liat1	T	C	11: 75,891,077 (GRCm39)	S64P	possibly damaging	Het
Lonp2	A	G	8: 87,392,403 (GRCm39)	T490A	probably damaging	Het
Lrrn3	A	T	12: 41,502,995 (GRCm39)	S441T	probably damaging	Het
Mpdz	G	A	4: 81,254,067 (GRCm39)	R1W	probably null	Het
Mpp4	G	A	1: 59,182,941 (GRCm39)	P322L	possibly damaging	Het
Mpzl2	G	A	9: 44,955,169 (GRCm39)		probably null	Het
Naf1	A	G	8: 67,340,432 (GRCm39)	D414G	probably damaging	Het
Notch3	A	G	17: 32,354,482 (GRCm39)	C1748R	probably benign	Het
Nup133	C	A	8: 124,641,314 (GRCm39)	D869Y	probably damaging	Het
Oasl2	A	C	5: 115,049,298 (GRCm39)	D466A	probably benign	Het
Opa3	T	C	7: 18,978,739 (GRCm39)	I68T	possibly damaging	Het
Or2ab1	A	G	11: 58,488,396 (GRCm39)	N58S	probably damaging	Het
Or2ag1	T	A	7: 106,313,373 (GRCm39)	R172W	probably benign	Het
Or2d3c	T	G	7: 106,526,162 (GRCm39)	Y168S	probably damaging	Het
Or5p63	T	C	7: 107,811,547 (GRCm39)	Y63C	probably damaging	Het
Or8g37	T	C	9: 39,731,846 (GRCm39)	F304L	probably benign	Het
Pcdh8	A	T	14: 80,005,651 (GRCm39)	S912R	probably damaging	Het
Pdzrn3	T	C	6: 101,127,660 (GRCm39)	E1002G	probably damaging	Het
Pik3c2a	A	T	7: 115,972,126 (GRCm39)	L768*	probably null	Het
Plxna4	A	G	6: 32,494,551 (GRCm39)	S22P	possibly damaging	Het
Plxnb3	T	A	X: 72,815,357 (GRCm39)	Y1845*	probably null	Het
Pramel11	T	C	4: 143,623,482 (GRCm39)	M231V	probably damaging	Het
Prl7a2	T	A	13: 27,844,870 (GRCm39)	Y172F	probably damaging	Het
Pum1	A	G	4: 130,501,745 (GRCm39)	T845A	probably benign	Het
Rad21l	T	C	2: 151,509,927 (GRCm39)	H58R	probably damaging	Het
Rgma	A	C	7: 73,059,379 (GRCm39)	D161A	probably damaging	Het
Scai	T	C	2: 39,013,025 (GRCm39)	Y135C	probably damaging	Het
Scn2a	T	A	2: 65,582,417 (GRCm39)	H1588Q	probably benign	Het
Sdha	A	T	13: 74,472,087 (GRCm39)		probably null	Het
Slc12a3	A	G	8: 95,072,456 (GRCm39)	D658G	probably damaging	Het
Slc5a3	A	G	16: 91,874,128 (GRCm39)	S62G	probably damaging	Het
Spata13	GTTAGGCT	GT	14: 60,998,320 (GRCm39)		probably benign	Het
Sulf1	A	G	1: 12,910,627 (GRCm39)	I649V	probably damaging	Het
Thbs1	C	T	2: 117,954,018 (GRCm39)	Q1090*	probably null	Het
Tjp2	C	A	19: 24,099,687 (GRCm39)	R400L	probably benign	Het
Tle4	A	T	19: 14,427,113 (GRCm39)	Y769*	probably null	Het
Trmt5	A	T	12: 73,331,444 (GRCm39)		probably null	Het
Troap	T	C	15: 98,980,344 (GRCm39)	L508P	probably benign	Het
Ubac2	T	A	14: 122,145,691 (GRCm39)	Y116*	probably null	Het
Ugt2b36	T	C	5: 87,240,100 (GRCm39)	E95G	probably benign	Het
Ush1c	T	C	7: 45,878,905 (GRCm39)	Y74C	probably damaging	Het
Usp36	T	C	11: 118,165,844 (GRCm39)	T160A	possibly damaging	Het
Usp54	G	T	14: 20,627,273 (GRCm39)	P462T	probably damaging	Het
Vmn1r55	A	G	7: 5,150,048 (GRCm39)	V125A	possibly damaging	Het
Vps11	A	G	9: 44,269,613 (GRCm39)	S213P	probably damaging	Het
Zfp668	C	T	7: 127,465,837 (GRCm39)	G449D	probably benign	Het

Other mutations in Cdh20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:Cdh20	APN	1	104,881,612 (GRCm39)	missense	probably benign	0.05
IGL00742:Cdh20	APN	1	109,993,356 (GRCm39)	missense	probably benign	0.22
IGL00743:Cdh20	APN	1	104,875,153 (GRCm39)	missense	probably benign	0.06
IGL00848:Cdh20	APN	1	104,861,981 (GRCm39)	missense	probably benign
IGL00861:Cdh20	APN	1	109,988,718 (GRCm39)	splice site	probably benign
IGL01016:Cdh20	APN	1	110,036,686 (GRCm39)	critical splice donor site	probably null
IGL01393:Cdh20	APN	1	104,861,969 (GRCm39)	missense	probably benign
IGL01396:Cdh20	APN	1	104,875,154 (GRCm39)	missense	possibly damaging	0.59
IGL01485:Cdh20	APN	1	104,861,832 (GRCm39)	missense	probably benign	0.05
IGL01538:Cdh20	APN	1	109,988,870 (GRCm39)	missense	probably damaging	1.00
IGL01612:Cdh20	APN	1	104,921,895 (GRCm39)	missense	probably benign	0.02
IGL01763:Cdh20	APN	1	109,993,520 (GRCm39)	missense	probably benign	0.00
IGL01765:Cdh20	APN	1	109,988,836 (GRCm39)	missense	probably damaging	1.00
IGL01937:Cdh20	APN	1	110,065,826 (GRCm39)	missense	probably benign
IGL01947:Cdh20	APN	1	104,921,649 (GRCm39)	missense	possibly damaging	0.91
IGL01967:Cdh20	APN	1	104,868,762 (GRCm39)	missense	probably damaging	1.00
IGL02020:Cdh20	APN	1	110,066,078 (GRCm39)	missense	probably damaging	1.00
IGL02135:Cdh20	APN	1	110,066,004 (GRCm39)	nonsense	probably null
IGL02226:Cdh20	APN	1	104,881,816 (GRCm39)	splice site	probably benign
IGL02285:Cdh20	APN	1	110,065,921 (GRCm39)	missense	probably damaging	1.00
IGL02318:Cdh20	APN	1	104,881,764 (GRCm39)	missense	probably null	0.03
IGL02326:Cdh20	APN	1	104,902,764 (GRCm39)	missense	probably damaging	0.97
IGL02798:Cdh20	APN	1	104,875,190 (GRCm39)	missense	probably damaging	0.97
IGL02963:Cdh20	APN	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.66
IGL03081:Cdh20	APN	1	104,868,982 (GRCm39)	missense	probably damaging	1.00
IGL03237:Cdh20	APN	1	110,066,037 (GRCm39)	missense	possibly damaging	0.89
IGL03280:Cdh20	APN	1	110,036,498 (GRCm39)	nonsense	probably null
IGL03347:Cdh20	APN	1	110,065,973 (GRCm39)	missense	possibly damaging	0.53
IGL03385:Cdh20	APN	1	109,993,516 (GRCm39)	missense	possibly damaging	0.90
3-1:Cdh20	UTSW	1	104,875,145 (GRCm39)	missense	possibly damaging	0.84
BB002:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
BB012:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
IGL02802:Cdh20	UTSW	1	110,065,655 (GRCm39)	missense	probably damaging	1.00
IGL02991:Cdh20	UTSW	1	104,861,972 (GRCm39)	missense	probably benign
R0030:Cdh20	UTSW	1	110,065,798 (GRCm39)	nonsense	probably null
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0070:Cdh20	UTSW	1	110,026,102 (GRCm39)	missense	probably benign	0.37
R0178:Cdh20	UTSW	1	104,902,776 (GRCm39)	missense	possibly damaging	0.82
R0255:Cdh20	UTSW	1	109,922,036 (GRCm39)	missense	probably benign	0.09
R0365:Cdh20	UTSW	1	110,036,486 (GRCm39)	missense	probably damaging	1.00
R0506:Cdh20	UTSW	1	110,027,844 (GRCm39)	missense	probably damaging	1.00
R0549:Cdh20	UTSW	1	110,036,674 (GRCm39)	missense	probably damaging	1.00
R0599:Cdh20	UTSW	1	109,980,696 (GRCm39)	missense	probably damaging	1.00
R0648:Cdh20	UTSW	1	109,993,337 (GRCm39)	splice site	probably benign
R1033:Cdh20	UTSW	1	110,012,783 (GRCm39)	missense	probably damaging	0.96
R1114:Cdh20	UTSW	1	104,906,739 (GRCm39)	missense	probably damaging	0.96
R1173:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1174:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1175:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1401:Cdh20	UTSW	1	104,875,222 (GRCm39)	missense	possibly damaging	0.65
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1403:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1406:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1502:Cdh20	UTSW	1	104,881,755 (GRCm39)	missense	probably benign	0.06
R1587:Cdh20	UTSW	1	110,027,757 (GRCm39)	missense	probably damaging	0.98
R1728:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1729:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1730:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1739:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1762:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1764:Cdh20	UTSW	1	104,862,070 (GRCm39)	splice site	probably benign
R1769:Cdh20	UTSW	1	109,980,606 (GRCm39)	missense	probably damaging	1.00
R1783:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1785:Cdh20	UTSW	1	109,993,465 (GRCm39)	missense	possibly damaging	0.53
R1940:Cdh20	UTSW	1	109,976,754 (GRCm39)	missense	probably benign	0.09
R1972:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1973:Cdh20	UTSW	1	109,988,862 (GRCm39)	missense	probably benign	0.10
R1997:Cdh20	UTSW	1	109,976,668 (GRCm39)	missense	probably damaging	1.00
R2060:Cdh20	UTSW	1	109,976,607 (GRCm39)	missense	probably damaging	1.00
R2069:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R2137:Cdh20	UTSW	1	110,027,836 (GRCm39)	missense	probably damaging	0.97
R2155:Cdh20	UTSW	1	109,976,594 (GRCm39)	missense	probably damaging	1.00
R2198:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R2279:Cdh20	UTSW	1	104,875,139 (GRCm39)	missense	probably damaging	1.00
R2419:Cdh20	UTSW	1	104,902,740 (GRCm39)	missense	possibly damaging	0.92
R2897:Cdh20	UTSW	1	104,875,199 (GRCm39)	missense	probably damaging	1.00
R3780:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3781:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R3782:Cdh20	UTSW	1	109,976,734 (GRCm39)	missense	probably benign	0.45
R4115:Cdh20	UTSW	1	110,066,039 (GRCm39)	missense	probably benign	0.37
R4243:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4244:Cdh20	UTSW	1	104,869,868 (GRCm39)	missense	probably damaging	1.00
R4277:Cdh20	UTSW	1	109,993,418 (GRCm39)	missense	probably benign	0.00
R4299:Cdh20	UTSW	1	109,988,731 (GRCm39)	missense	probably damaging	0.99
R4349:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4350:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4352:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4353:Cdh20	UTSW	1	104,906,814 (GRCm39)	missense	probably damaging	1.00
R4719:Cdh20	UTSW	1	104,862,035 (GRCm39)	missense	probably damaging	0.97
R4754:Cdh20	UTSW	1	104,912,410 (GRCm39)	missense	probably damaging	0.99
R4777:Cdh20	UTSW	1	109,922,055 (GRCm39)	nonsense	probably null
R4795:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4796:Cdh20	UTSW	1	104,868,989 (GRCm39)	missense	probably damaging	1.00
R4907:Cdh20	UTSW	1	110,066,053 (GRCm39)	missense	probably damaging	1.00
R4955:Cdh20	UTSW	1	104,912,528 (GRCm39)	missense	probably damaging	1.00
R5045:Cdh20	UTSW	1	110,026,080 (GRCm39)	missense	probably benign	0.01
R5056:Cdh20	UTSW	1	104,881,722 (GRCm39)	missense	probably benign	0.00
R5059:Cdh20	UTSW	1	109,993,430 (GRCm39)	missense	probably damaging	0.98
R5127:Cdh20	UTSW	1	104,875,073 (GRCm39)	missense	probably damaging	1.00
R5146:Cdh20	UTSW	1	109,922,042 (GRCm39)	missense	probably damaging	0.97
R5196:Cdh20	UTSW	1	110,065,730 (GRCm39)	missense	probably damaging	0.99
R5269:Cdh20	UTSW	1	104,861,882 (GRCm39)	missense	possibly damaging	0.67
R5304:Cdh20	UTSW	1	110,036,569 (GRCm39)	missense	probably damaging	1.00
R5496:Cdh20	UTSW	1	109,976,647 (GRCm39)	missense	probably damaging	1.00
R5563:Cdh20	UTSW	1	104,875,082 (GRCm39)	missense	probably benign	0.29
R5634:Cdh20	UTSW	1	104,902,800 (GRCm39)	missense	probably damaging	0.97
R5708:Cdh20	UTSW	1	104,912,635 (GRCm39)	missense	probably damaging	1.00
R5743:Cdh20	UTSW	1	110,036,575 (GRCm39)	missense	probably damaging	1.00
R5822:Cdh20	UTSW	1	104,861,823 (GRCm39)	start codon destroyed	probably null	0.49
R5867:Cdh20	UTSW	1	109,976,581 (GRCm39)	missense	probably damaging	1.00
R5933:Cdh20	UTSW	1	104,912,396 (GRCm39)	missense	probably damaging	1.00
R6042:Cdh20	UTSW	1	110,065,997 (GRCm39)	missense	probably damaging	0.97
R6092:Cdh20	UTSW	1	110,026,036 (GRCm39)	missense	probably benign	0.00
R6109:Cdh20	UTSW	1	104,921,739 (GRCm39)	missense	probably damaging	1.00
R6497:Cdh20	UTSW	1	109,993,528 (GRCm39)	critical splice donor site	probably null
R6521:Cdh20	UTSW	1	104,869,859 (GRCm39)	missense	probably damaging	1.00
R6911:Cdh20	UTSW	1	104,912,411 (GRCm39)	missense	possibly damaging	0.95
R7111:Cdh20	UTSW	1	110,065,638 (GRCm39)	missense
R7169:Cdh20	UTSW	1	104,875,078 (GRCm39)	missense	possibly damaging	0.91
R7207:Cdh20	UTSW	1	104,921,702 (GRCm39)	missense	probably damaging	0.98
R7208:Cdh20	UTSW	1	104,881,796 (GRCm39)	missense	possibly damaging	0.63
R7297:Cdh20	UTSW	1	104,898,598 (GRCm39)	missense	probably benign
R7511:Cdh20	UTSW	1	109,925,583 (GRCm39)	intron	probably benign
R7532:Cdh20	UTSW	1	110,065,889 (GRCm39)	missense	probably damaging	1.00
R7535:Cdh20	UTSW	1	104,902,768 (GRCm39)	missense	probably damaging	1.00
R7587:Cdh20	UTSW	1	104,869,004 (GRCm39)	missense	probably damaging	1.00
R7748:Cdh20	UTSW	1	104,869,024 (GRCm39)	missense	probably damaging	1.00
R7879:Cdh20	UTSW	1	109,976,677 (GRCm39)	missense	probably benign	0.01
R7879:Cdh20	UTSW	1	104,875,047 (GRCm39)	critical splice acceptor site	probably null
R7915:Cdh20	UTSW	1	104,861,898 (GRCm39)	missense	probably benign	0.15
R7925:Cdh20	UTSW	1	104,912,473 (GRCm39)	missense	probably damaging	0.99
R7978:Cdh20	UTSW	1	109,921,835 (GRCm39)	start gained	probably benign
R8022:Cdh20	UTSW	1	109,988,838 (GRCm39)	missense	probably benign	0.02
R8207:Cdh20	UTSW	1	109,922,076 (GRCm39)	missense	probably damaging	1.00
R8224:Cdh20	UTSW	1	109,921,933 (GRCm39)	missense	probably benign
R8239:Cdh20	UTSW	1	110,027,832 (GRCm39)	missense	probably benign	0.11
R8257:Cdh20	UTSW	1	104,921,962 (GRCm39)	missense	probably benign	0.25
R8444:Cdh20	UTSW	1	104,898,583 (GRCm39)	missense	probably benign	0.16
R8546:Cdh20	UTSW	1	104,861,769 (GRCm39)	start gained	probably benign
R8749:Cdh20	UTSW	1	110,027,009 (GRCm39)	missense	probably damaging	1.00
R8870:Cdh20	UTSW	1	104,873,048 (GRCm39)	missense	probably damaging	0.99
R8884:Cdh20	UTSW	1	110,027,860 (GRCm39)	missense	probably damaging	1.00
R9030:Cdh20	UTSW	1	110,027,843 (GRCm39)	missense	probably benign	0.21
R9310:Cdh20	UTSW	1	104,875,061 (GRCm39)	missense	probably damaging	1.00
R9498:Cdh20	UTSW	1	109,976,635 (GRCm39)	missense	probably benign	0.03
R9542:Cdh20	UTSW	1	104,875,067 (GRCm39)	missense	probably damaging	1.00
R9602:Cdh20	UTSW	1	104,868,823 (GRCm39)	missense	probably benign	0.07
R9658:Cdh20	UTSW	1	109,988,785 (GRCm39)	missense	probably damaging	0.99
R9664:Cdh20	UTSW	1	104,862,065 (GRCm39)	missense	probably benign	0.10
Z1088:Cdh20	UTSW	1	110,012,853 (GRCm39)	missense	probably benign	0.01
Z1176:Cdh20	UTSW	1	110,036,466 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTCCCGTGAAACAGGGAAG -3'
(R):5'- GATCCACATCAGCTTCTTTCAG -3'

Sequencing Primer
(F):5'- CAGGGAAGCCAAACTTTTTGC -3'
(R):5'- CCCTAAAAATGACATTATCTGGGATG -3'

Posted On

2014-09-17