Incidental Mutation 'R2068:Dapk1'
ID 226871
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Name death associated protein kinase 1
Synonyms DAP-Kinase, D13Ucla1, 2810425C21Rik, 2310039H24Rik
MMRRC Submission 040073-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2068 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 60749761-60911005 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 60899022 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 831 (D831N)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
AlphaFold Q80YE7
Predicted Effect probably damaging
Transcript: ENSMUST00000044083
AA Change: D831N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: D831N

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077453
AA Change: D831N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: D831N

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225952
Predicted Effect probably damaging
Transcript: ENSMUST00000226059
AA Change: D831N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933436I01Rik T A X: 66,964,308 (GRCm39) I184L probably benign Het
Abcb5 A T 12: 118,904,303 (GRCm39) C162* probably null Het
Akr1c19 A T 13: 4,288,391 (GRCm39) probably null Het
Akt3 A G 1: 176,930,551 (GRCm39) S136P possibly damaging Het
Alox12e G A 11: 70,206,828 (GRCm39) R620W probably damaging Het
Ascc2 A T 11: 4,631,496 (GRCm39) M646L probably benign Het
Bsn T G 9: 107,987,883 (GRCm39) probably benign Het
Bsn T A 9: 108,003,749 (GRCm39) M219L possibly damaging Het
Btnl9 T C 11: 49,060,390 (GRCm39) T453A probably damaging Het
C6 G T 15: 4,820,552 (GRCm39) C521F probably damaging Het
Ccnt1 A T 15: 98,449,823 (GRCm39) H156Q probably benign Het
Cdh20 A T 1: 110,065,666 (GRCm39) R647* probably null Het
Clptm1l C T 13: 73,755,842 (GRCm39) Q153* probably null Het
Cmya5 T A 13: 93,227,032 (GRCm39) K2685N possibly damaging Het
Cnksr2 A C X: 156,728,302 (GRCm39) S224R possibly damaging Het
Cntn1 T C 15: 92,215,943 (GRCm39) V992A possibly damaging Het
Dnaaf3 T C 7: 4,526,798 (GRCm39) I426M possibly damaging Het
Dnah6 A G 6: 72,998,165 (GRCm39) Y4034H probably benign Het
Dtx2 C T 5: 136,059,431 (GRCm39) S493F probably damaging Het
Ehd1 T C 19: 6,348,108 (GRCm39) L362P probably benign Het
Endov T C 11: 119,390,408 (GRCm39) F12S probably damaging Het
Eps8 A T 6: 137,499,172 (GRCm39) W239R probably benign Het
Fance T C 17: 28,539,799 (GRCm39) F83S possibly damaging Het
Fn1 A G 1: 71,639,598 (GRCm39) V1731A probably damaging Het
Gak G T 5: 108,718,091 (GRCm39) T1244K probably benign Het
Gas8 T A 8: 124,253,276 (GRCm39) I208N probably damaging Het
Gm9830 A T 9: 44,375,579 (GRCm39) noncoding transcript Het
Gm9837 T A 11: 53,361,092 (GRCm39) probably benign Het
Gtf2f2 A G 14: 76,155,136 (GRCm39) S142P possibly damaging Het
Hdac3 C A 18: 38,076,569 (GRCm39) G257V probably damaging Het
Heg1 A G 16: 33,547,960 (GRCm39) T916A probably benign Het
Herc2 G T 7: 55,782,245 (GRCm39) G1311C probably damaging Het
Htt C T 5: 34,983,326 (GRCm39) T975I probably benign Het
Il2rg A G X: 100,311,416 (GRCm39) L57P possibly damaging Het
Itm2b T C 14: 73,600,575 (GRCm39) K242E probably damaging Het
Itpr3 G A 17: 27,317,050 (GRCm39) M768I probably benign Het
Klrg2 G A 6: 38,613,928 (GRCm39) T25I probably benign Het
Lcn5 G A 2: 25,548,053 (GRCm39) V21M probably damaging Het
Liat1 T C 11: 75,891,077 (GRCm39) S64P possibly damaging Het
Lonp2 A G 8: 87,392,403 (GRCm39) T490A probably damaging Het
Lrrn3 A T 12: 41,502,995 (GRCm39) S441T probably damaging Het
Mpdz G A 4: 81,254,067 (GRCm39) R1W probably null Het
Mpp4 G A 1: 59,182,941 (GRCm39) P322L possibly damaging Het
Mpzl2 G A 9: 44,955,169 (GRCm39) probably null Het
Naf1 A G 8: 67,340,432 (GRCm39) D414G probably damaging Het
Notch3 A G 17: 32,354,482 (GRCm39) C1748R probably benign Het
Nup133 C A 8: 124,641,314 (GRCm39) D869Y probably damaging Het
Oasl2 A C 5: 115,049,298 (GRCm39) D466A probably benign Het
Opa3 T C 7: 18,978,739 (GRCm39) I68T possibly damaging Het
Or2ab1 A G 11: 58,488,396 (GRCm39) N58S probably damaging Het
Or2ag1 T A 7: 106,313,373 (GRCm39) R172W probably benign Het
Or2d3c T G 7: 106,526,162 (GRCm39) Y168S probably damaging Het
Or5p63 T C 7: 107,811,547 (GRCm39) Y63C probably damaging Het
Or8g37 T C 9: 39,731,846 (GRCm39) F304L probably benign Het
Pcdh8 A T 14: 80,005,651 (GRCm39) S912R probably damaging Het
Pdzrn3 T C 6: 101,127,660 (GRCm39) E1002G probably damaging Het
Pik3c2a A T 7: 115,972,126 (GRCm39) L768* probably null Het
Plxna4 A G 6: 32,494,551 (GRCm39) S22P possibly damaging Het
Plxnb3 T A X: 72,815,357 (GRCm39) Y1845* probably null Het
Pramel11 T C 4: 143,623,482 (GRCm39) M231V probably damaging Het
Prl7a2 T A 13: 27,844,870 (GRCm39) Y172F probably damaging Het
Pum1 A G 4: 130,501,745 (GRCm39) T845A probably benign Het
Rad21l T C 2: 151,509,927 (GRCm39) H58R probably damaging Het
Rgma A C 7: 73,059,379 (GRCm39) D161A probably damaging Het
Scai T C 2: 39,013,025 (GRCm39) Y135C probably damaging Het
Scn2a T A 2: 65,582,417 (GRCm39) H1588Q probably benign Het
Sdha A T 13: 74,472,087 (GRCm39) probably null Het
Slc12a3 A G 8: 95,072,456 (GRCm39) D658G probably damaging Het
Slc5a3 A G 16: 91,874,128 (GRCm39) S62G probably damaging Het
Spata13 GTTAGGCT GT 14: 60,998,320 (GRCm39) probably benign Het
Sulf1 A G 1: 12,910,627 (GRCm39) I649V probably damaging Het
Thbs1 C T 2: 117,954,018 (GRCm39) Q1090* probably null Het
Tjp2 C A 19: 24,099,687 (GRCm39) R400L probably benign Het
Tle4 A T 19: 14,427,113 (GRCm39) Y769* probably null Het
Trmt5 A T 12: 73,331,444 (GRCm39) probably null Het
Troap T C 15: 98,980,344 (GRCm39) L508P probably benign Het
Ubac2 T A 14: 122,145,691 (GRCm39) Y116* probably null Het
Ugt2b36 T C 5: 87,240,100 (GRCm39) E95G probably benign Het
Ush1c T C 7: 45,878,905 (GRCm39) Y74C probably damaging Het
Usp36 T C 11: 118,165,844 (GRCm39) T160A possibly damaging Het
Usp54 G T 14: 20,627,273 (GRCm39) P462T probably damaging Het
Vmn1r55 A G 7: 5,150,048 (GRCm39) V125A possibly damaging Het
Vps11 A G 9: 44,269,613 (GRCm39) S213P probably damaging Het
Zfp668 C T 7: 127,465,837 (GRCm39) G449D probably benign Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60,908,854 (GRCm39) missense probably benign 0.23
IGL00500:Dapk1 APN 13 60,908,618 (GRCm39) missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60,909,062 (GRCm39) missense probably benign 0.00
IGL00903:Dapk1 APN 13 60,909,211 (GRCm39) missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60,908,612 (GRCm39) missense probably benign
IGL01535:Dapk1 APN 13 60,878,845 (GRCm39) splice site probably benign
IGL01755:Dapk1 APN 13 60,908,990 (GRCm39) missense possibly damaging 0.63
IGL01755:Dapk1 APN 13 60,908,989 (GRCm39) missense probably damaging 0.97
IGL01862:Dapk1 APN 13 60,874,424 (GRCm39) missense probably benign 0.39
IGL01985:Dapk1 APN 13 60,884,074 (GRCm39) missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60,878,696 (GRCm39) missense probably benign
IGL02376:Dapk1 APN 13 60,844,208 (GRCm39) missense probably benign 0.00
IGL02449:Dapk1 APN 13 60,867,584 (GRCm39) splice site probably benign
IGL02490:Dapk1 APN 13 60,897,148 (GRCm39) missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60,909,621 (GRCm39) nonsense probably null
IGL02516:Dapk1 APN 13 60,844,161 (GRCm39) missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60,899,031 (GRCm39) missense probably benign
IGL02604:Dapk1 APN 13 60,896,134 (GRCm39) missense probably benign
IGL03035:Dapk1 APN 13 60,864,587 (GRCm39) missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60,909,126 (GRCm39) missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60,865,963 (GRCm39) splice site probably benign
R0116:Dapk1 UTSW 13 60,908,914 (GRCm39) missense probably benign
R0165:Dapk1 UTSW 13 60,909,407 (GRCm39) missense probably benign 0.39
R0357:Dapk1 UTSW 13 60,877,372 (GRCm39) nonsense probably null
R0446:Dapk1 UTSW 13 60,873,101 (GRCm39) splice site probably null
R0502:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0503:Dapk1 UTSW 13 60,878,662 (GRCm39) splice site probably null
R0597:Dapk1 UTSW 13 60,909,198 (GRCm39) missense probably benign 0.40
R0614:Dapk1 UTSW 13 60,865,946 (GRCm39) missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60,905,262 (GRCm39) missense probably benign 0.14
R1023:Dapk1 UTSW 13 60,878,799 (GRCm39) missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60,869,679 (GRCm39) critical splice donor site probably null
R1101:Dapk1 UTSW 13 60,864,599 (GRCm39) missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60,844,112 (GRCm39) missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60,901,957 (GRCm39) missense probably benign 0.28
R1630:Dapk1 UTSW 13 60,877,345 (GRCm39) missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60,866,278 (GRCm39) critical splice donor site probably null
R1799:Dapk1 UTSW 13 60,867,468 (GRCm39) missense probably damaging 1.00
R2012:Dapk1 UTSW 13 60,869,671 (GRCm39) missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60,909,481 (GRCm39) missense possibly damaging 0.80
R2131:Dapk1 UTSW 13 60,877,345 (GRCm39) missense possibly damaging 0.91
R2154:Dapk1 UTSW 13 60,877,317 (GRCm39) missense probably benign 0.36
R2288:Dapk1 UTSW 13 60,909,563 (GRCm39) missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60,905,167 (GRCm39) missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60,878,745 (GRCm39) missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60,900,030 (GRCm39) missense probably benign 0.34
R2909:Dapk1 UTSW 13 60,864,631 (GRCm39) critical splice donor site probably null
R2926:Dapk1 UTSW 13 60,867,564 (GRCm39) missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60,896,014 (GRCm39) missense probably benign 0.09
R3810:Dapk1 UTSW 13 60,908,503 (GRCm39) missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4375:Dapk1 UTSW 13 60,909,403 (GRCm39) missense probably benign
R4377:Dapk1 UTSW 13 60,867,498 (GRCm39) missense probably benign 0.01
R4490:Dapk1 UTSW 13 60,865,942 (GRCm39) missense probably benign 0.26
R4576:Dapk1 UTSW 13 60,869,636 (GRCm39) missense probably benign 0.13
R4599:Dapk1 UTSW 13 60,865,861 (GRCm39) missense probably benign 0.22
R4682:Dapk1 UTSW 13 60,898,961 (GRCm39) missense probably benign 0.41
R4717:Dapk1 UTSW 13 60,874,476 (GRCm39) critical splice donor site probably null
R4775:Dapk1 UTSW 13 60,897,156 (GRCm39) missense probably benign 0.02
R4790:Dapk1 UTSW 13 60,870,919 (GRCm39) frame shift probably null
R4897:Dapk1 UTSW 13 60,909,600 (GRCm39) missense probably benign 0.01
R4931:Dapk1 UTSW 13 60,908,774 (GRCm39) missense probably benign 0.04
R5113:Dapk1 UTSW 13 60,869,592 (GRCm39) missense probably benign 0.01
R5503:Dapk1 UTSW 13 60,873,126 (GRCm39) missense probably benign 0.15
R5948:Dapk1 UTSW 13 60,877,209 (GRCm39) missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60,909,476 (GRCm39) missense probably benign 0.00
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60,909,013 (GRCm39) missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60,909,580 (GRCm39) missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60,909,140 (GRCm39) missense probably benign 0.01
R6331:Dapk1 UTSW 13 60,877,256 (GRCm39) nonsense probably null
R6553:Dapk1 UTSW 13 60,908,975 (GRCm39) missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60,909,161 (GRCm39) missense probably benign 0.03
R6602:Dapk1 UTSW 13 60,897,018 (GRCm39) missense probably benign 0.20
R6640:Dapk1 UTSW 13 60,864,628 (GRCm39) missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60,908,708 (GRCm39) missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60,873,154 (GRCm39) missense probably benign 0.22
R6799:Dapk1 UTSW 13 60,900,049 (GRCm39) missense probably benign
R6809:Dapk1 UTSW 13 60,899,103 (GRCm39) missense probably benign 0.00
R6915:Dapk1 UTSW 13 60,844,256 (GRCm39) missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60,884,138 (GRCm39) missense probably benign 0.11
R6979:Dapk1 UTSW 13 60,896,095 (GRCm39) missense probably damaging 1.00
R7161:Dapk1 UTSW 13 60,844,209 (GRCm39) missense possibly damaging 0.89
R7171:Dapk1 UTSW 13 60,909,599 (GRCm39) missense probably damaging 0.97
R7199:Dapk1 UTSW 13 60,902,024 (GRCm39) missense probably benign 0.02
R7203:Dapk1 UTSW 13 60,844,149 (GRCm39) missense possibly damaging 0.90
R7404:Dapk1 UTSW 13 60,867,455 (GRCm39) missense probably benign 0.00
R7448:Dapk1 UTSW 13 60,898,990 (GRCm39) missense probably damaging 1.00
R7480:Dapk1 UTSW 13 60,905,311 (GRCm39) missense probably benign 0.18
R7532:Dapk1 UTSW 13 60,878,700 (GRCm39) missense probably damaging 1.00
R7574:Dapk1 UTSW 13 60,908,987 (GRCm39) missense probably damaging 1.00
R7711:Dapk1 UTSW 13 60,909,365 (GRCm39) missense probably damaging 1.00
R7753:Dapk1 UTSW 13 60,899,007 (GRCm39) missense possibly damaging 0.58
R7804:Dapk1 UTSW 13 60,873,153 (GRCm39) missense probably benign 0.41
R7822:Dapk1 UTSW 13 60,873,715 (GRCm39) missense probably benign 0.05
R7973:Dapk1 UTSW 13 60,909,377 (GRCm39) missense probably damaging 1.00
R8103:Dapk1 UTSW 13 60,897,009 (GRCm39) missense probably damaging 0.98
R8121:Dapk1 UTSW 13 60,909,212 (GRCm39) missense probably damaging 0.99
R8245:Dapk1 UTSW 13 60,878,710 (GRCm39) missense probably benign
R8401:Dapk1 UTSW 13 60,870,904 (GRCm39) missense probably benign 0.01
R8419:Dapk1 UTSW 13 60,887,911 (GRCm39) missense probably benign 0.00
R8926:Dapk1 UTSW 13 60,908,734 (GRCm39) missense probably damaging 0.98
R9063:Dapk1 UTSW 13 60,866,264 (GRCm39) missense probably benign 0.06
R9131:Dapk1 UTSW 13 60,909,208 (GRCm39) missense probably damaging 1.00
R9176:Dapk1 UTSW 13 60,866,262 (GRCm39) missense probably damaging 1.00
R9301:Dapk1 UTSW 13 60,866,125 (GRCm39) missense possibly damaging 0.92
R9407:Dapk1 UTSW 13 60,898,991 (GRCm39) nonsense probably null
R9491:Dapk1 UTSW 13 60,877,369 (GRCm39) missense probably benign 0.44
R9510:Dapk1 UTSW 13 60,910,203 (GRCm39) missense unknown
R9624:Dapk1 UTSW 13 60,895,937 (GRCm39) missense probably benign 0.31
R9726:Dapk1 UTSW 13 60,898,948 (GRCm39) missense probably benign 0.25
R9794:Dapk1 UTSW 13 60,909,082 (GRCm39) missense probably damaging 0.98
Z1176:Dapk1 UTSW 13 60,908,618 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCACTGGATATGAGGAGCAC -3'
(R):5'- ATGTGCACCCCAATAGAAGCAG -3'

Sequencing Primer
(F):5'- GACACATGTTGCAGATGTCACTG -3'
(R):5'- CCCAATAGAAGCAGCTCAGGG -3'
Posted On 2014-09-17