Incidental Mutation 'R2069:Cntnap5b'
ID226904
Institutional Source Beutler Lab
Gene Symbol Cntnap5b
Ensembl Gene ENSMUSG00000067028
Gene Namecontactin associated protein-like 5B
SynonymsCaspr5-2, C230078M14Rik
MMRRC Submission 040074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R2069 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location99772765-100485942 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 100358725 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 402 (G402R)
Ref Sequence ENSEMBL: ENSMUSP00000139877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086738] [ENSMUST00000188735]
Predicted Effect probably benign
Transcript: ENSMUST00000086738
AA Change: G716R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000083944
Gene: ENSMUSG00000067028
AA Change: G716R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 39 174 2.76e-16 SMART
LamG 201 338 2.84e-27 SMART
LamG 387 521 9.22e-27 SMART
EGF 549 583 1.14e0 SMART
Blast:FBG 586 758 3e-66 BLAST
LamG 798 925 2.12e-26 SMART
EGF 946 982 1.51e0 SMART
LamG 1023 1159 2.14e-13 SMART
transmembrane domain 1227 1249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185484
Predicted Effect probably benign
Transcript: ENSMUST00000188735
AA Change: G402R

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139877
Gene: ENSMUSG00000067028
AA Change: G402R

DomainStartEndE-ValueType
LamG 73 207 5.9e-29 SMART
EGF 235 269 5.6e-3 SMART
Blast:FBG 272 402 2e-42 BLAST
LamG 415 554 2.5e-11 SMART
EGF 575 611 7.1e-3 SMART
LamG 652 788 1.4e-15 SMART
transmembrane domain 856 878 N/A INTRINSIC
Meta Mutation Damage Score 0.2267 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (104/104)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,874,280 V86A probably benign Het
Abcc3 A T 11: 94,364,417 I601N probably damaging Het
Abl2 T A 1: 156,620,827 probably null Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ahi1 C T 10: 20,959,996 T76I probably damaging Het
Arhgap42 C T 9: 9,035,600 G247D probably damaging Het
Arid2 C T 15: 96,362,590 L407F probably damaging Het
Atp13a1 T C 8: 69,799,773 F606L probably benign Het
Avl9 T A 6: 56,736,435 probably benign Het
B3glct C T 5: 149,709,380 A65V probably damaging Het
Bcorl1 T C X: 48,401,917 probably benign Het
Bdp1 T C 13: 100,050,988 T1624A probably benign Het
Bmp15 A G X: 6,316,021 M263T probably benign Het
Brd8 T C 18: 34,614,479 K110E probably damaging Het
Cachd1 A G 4: 100,990,844 D1052G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc113 G A 8: 95,557,296 E333K probably benign Het
Ccnl2 A T 4: 155,812,481 probably null Het
Ccr9 T C 9: 123,779,364 F37S probably benign Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Ceacam10 A T 7: 24,778,372 N104I probably damaging Het
Cenpk T A 13: 104,236,176 probably benign Het
Cfi A G 3: 129,858,804 probably null Het
Chd1 T C 17: 15,742,294 F771S probably damaging Het
Chil4 G A 3: 106,219,455 L4F probably benign Het
Cilp G A 9: 65,278,090 R489Q possibly damaging Het
Coq8b A G 7: 27,257,377 E485G probably damaging Het
Cse1l A G 2: 166,941,492 S733G probably benign Het
Dnah5 G A 15: 28,312,388 probably null Het
Dnmt3l T C 10: 78,052,732 V156A probably damaging Het
Duox1 A T 2: 122,333,062 T792S probably benign Het
Duox2 T C 2: 122,287,108 D915G probably benign Het
Efcab5 A T 11: 77,172,321 M115K probably benign Het
Eif2s1 G A 12: 78,877,185 D139N probably benign Het
Erg A G 16: 95,361,078 F390L probably damaging Het
Fam193b A T 13: 55,542,998 S650R probably damaging Het
Fbp2 T A 13: 62,854,061 K113N possibly damaging Het
Fnbp4 T G 2: 90,758,372 S496A probably damaging Het
Gab3 C A X: 75,000,095 R475L probably damaging Het
Gm7534 T G 4: 134,201,941 N351T possibly damaging Het
Gsap T C 5: 21,226,839 probably benign Het
Gucy1a2 C T 9: 3,582,697 L160F probably damaging Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Hrasls5 T C 19: 7,612,638 S10P possibly damaging Het
Insc G T 7: 114,804,593 probably null Het
Jph2 A G 2: 163,339,685 S520P possibly damaging Het
Kidins220 T A 12: 24,987,006 probably benign Het
Krtap29-1 A G 11: 99,978,612 S148P probably damaging Het
Ltbp2 A C 12: 84,793,733 C1000G probably damaging Het
Map2k3 T C 11: 60,950,027 F294S probably damaging Het
Map4k2 C A 19: 6,342,738 probably benign Het
Mboat2 T C 12: 24,951,443 V281A probably benign Het
Mdga2 G A 12: 66,568,917 R570* probably null Het
Mlxipl A G 5: 135,107,005 D28G probably damaging Het
Morc2b T C 17: 33,136,760 I679M probably benign Het
Myh4 T C 11: 67,246,366 probably benign Het
Nfib A C 4: 82,498,615 L61R probably damaging Het
Noc2l C A 4: 156,241,450 Y227* probably null Het
Nrde2 A G 12: 100,142,232 S367P probably damaging Het
Nup93 C A 8: 94,243,739 P89T probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1283 A G 2: 111,369,095 I154M probably benign Het
Olfr6 A T 7: 106,956,287 Y216* probably null Het
Olfr714 A T 7: 107,074,619 K264* probably null Het
Olfr749 T A 14: 50,736,576 E195D possibly damaging Het
Olfr824 A G 10: 130,126,205 I284T possibly damaging Het
Oxct1 G T 15: 4,092,525 A319S probably null Het
P2ry10 A G X: 107,103,253 S265G probably benign Het
Peak1 A T 9: 56,258,759 N628K probably damaging Het
Pkdrej T A 15: 85,821,231 Q168L probably benign Het
Plec A G 15: 76,188,926 M604T probably benign Het
Pmfbp1 A T 8: 109,532,103 N680I possibly damaging Het
Pnmal2 T C 7: 16,945,789 W233R probably damaging Het
Pxn A G 5: 115,545,667 N186S probably benign Het
Rsad1 A C 11: 94,549,125 probably benign Het
Runx2 A G 17: 44,735,342 I112T probably benign Het
S1pr2 A T 9: 20,967,494 L346Q probably damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Slc36a4 T A 9: 15,726,980 F234Y probably damaging Het
Slitrk2 T A X: 66,654,629 V242D probably damaging Het
Sp100 A G 1: 85,681,142 probably null Het
Spryd3 A C 15: 102,118,181 L352V probably benign Het
Ssc4d A C 5: 135,970,317 W11G possibly damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tlk2 A T 11: 105,240,440 Q204L probably benign Het
Tnfrsf21 A T 17: 43,037,938 H147L possibly damaging Het
Tnrc18 A T 5: 142,766,087 D1154E unknown Het
Trap1 A G 16: 4,068,336 S86P probably benign Het
Trim32 T A 4: 65,614,776 C523* probably null Het
Ttc38 G T 15: 85,838,788 D146Y probably damaging Het
Ttc9 T A 12: 81,631,796 L131Q probably damaging Het
Ttn T C 2: 76,726,848 probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubash3b G A 9: 41,043,573 P92S possibly damaging Het
Ube4a T C 9: 44,948,099 N367S probably damaging Het
Ubr4 T A 4: 139,479,540 H4899Q possibly damaging Het
Ufl1 C T 4: 25,269,036 G265D possibly damaging Het
Vmn2r27 T A 6: 124,224,483 I172F probably damaging Het
Vmn2r6 A T 3: 64,556,098 H438Q possibly damaging Het
Vmn2r61 A G 7: 42,300,001 D615G probably benign Het
Wdr24 T A 17: 25,826,282 D330E probably damaging Het
Zbbx A T 3: 75,078,412 N444K probably benign Het
Zc3h7b A T 15: 81,792,328 Q757L probably damaging Het
Other mutations in Cntnap5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Cntnap5b APN 1 100050754 missense probably damaging 1.00
IGL00477:Cntnap5b APN 1 100213743 missense probably damaging 0.97
IGL00505:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00596:Cntnap5b APN 1 100379161 missense possibly damaging 0.81
IGL00846:Cntnap5b APN 1 100164223 missense probably damaging 1.00
IGL00895:Cntnap5b APN 1 100383585 missense probably damaging 0.98
IGL00948:Cntnap5b APN 1 100141357 missense probably benign 0.00
IGL01073:Cntnap5b APN 1 100076030 missense probably benign 0.08
IGL01523:Cntnap5b APN 1 100431779 missense probably benign 0.02
IGL01779:Cntnap5b APN 1 99967339 missense probably damaging 1.00
IGL02253:Cntnap5b APN 1 100164211 missense possibly damaging 0.75
IGL02628:Cntnap5b APN 1 100072069 missense probably damaging 0.97
R0166:Cntnap5b UTSW 1 100274361 missense probably benign 0.41
R0211:Cntnap5b UTSW 1 100478374 missense possibly damaging 0.82
R0281:Cntnap5b UTSW 1 100072153 missense probably benign 0.22
R0363:Cntnap5b UTSW 1 100274468 missense probably benign 0.01
R0514:Cntnap5b UTSW 1 99772786 missense probably benign
R0645:Cntnap5b UTSW 1 100072042 splice site probably benign
R0848:Cntnap5b UTSW 1 100255163 missense probably benign 0.22
R1006:Cntnap5b UTSW 1 100383617 missense probably benign 0.00
R1349:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1372:Cntnap5b UTSW 1 100164088 missense probably benign 0.09
R1474:Cntnap5b UTSW 1 100072089 missense probably benign 0.25
R1681:Cntnap5b UTSW 1 100076107 missense probably damaging 0.98
R1727:Cntnap5b UTSW 1 100213744 missense possibly damaging 0.91
R1760:Cntnap5b UTSW 1 99772810 missense probably benign 0.05
R1777:Cntnap5b UTSW 1 100370078 missense probably benign 0.10
R1939:Cntnap5b UTSW 1 99967348 missense probably benign
R1988:Cntnap5b UTSW 1 100072140 missense possibly damaging 0.92
R2113:Cntnap5b UTSW 1 100274415 missense probably benign
R2148:Cntnap5b UTSW 1 100383474 missense probably benign 0.01
R2158:Cntnap5b UTSW 1 100390572 missense probably damaging 1.00
R2223:Cntnap5b UTSW 1 100213687 missense probably damaging 1.00
R2350:Cntnap5b UTSW 1 100379126 missense probably damaging 1.00
R3840:Cntnap5b UTSW 1 100383477 missense possibly damaging 0.50
R4329:Cntnap5b UTSW 1 100072163 missense probably damaging 0.99
R4609:Cntnap5b UTSW 1 99772847 critical splice donor site probably null
R4799:Cntnap5b UTSW 1 100358725 missense probably benign 0.04
R5129:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R5323:Cntnap5b UTSW 1 100383550 nonsense probably null
R5434:Cntnap5b UTSW 1 100072201 missense probably benign 0.02
R5579:Cntnap5b UTSW 1 100383395 nonsense probably null
R5579:Cntnap5b UTSW 1 100383399 missense probably benign 0.27
R5630:Cntnap5b UTSW 1 100072069 missense probably damaging 0.99
R5644:Cntnap5b UTSW 1 100383601 missense probably benign 0.00
R5761:Cntnap5b UTSW 1 100446894 missense probably damaging 1.00
R6042:Cntnap5b UTSW 1 100390592 missense probably benign
R6147:Cntnap5b UTSW 1 100050781 missense probably damaging 1.00
R6190:Cntnap5b UTSW 1 100379075 missense possibly damaging 0.80
R6248:Cntnap5b UTSW 1 100072102 missense probably benign 0.30
R6286:Cntnap5b UTSW 1 100255073 missense possibly damaging 0.82
R6306:Cntnap5b UTSW 1 100164146 missense probably damaging 1.00
R6336:Cntnap5b UTSW 1 100358669 missense probably benign 0.00
R6360:Cntnap5b UTSW 1 100431736 nonsense probably null
R6722:Cntnap5b UTSW 1 100478486 missense probably damaging 0.98
R6750:Cntnap5b UTSW 1 100274499 missense probably damaging 1.00
R6806:Cntnap5b UTSW 1 99940649 missense probably damaging 1.00
R6933:Cntnap5b UTSW 1 100383450 missense probably benign 0.01
R6957:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6958:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6959:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6961:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R6962:Cntnap5b UTSW 1 100274472 missense probably benign 0.08
R7088:Cntnap5b UTSW 1 100160077 missense probably damaging 0.99
R7146:Cntnap5b UTSW 1 100050794 splice site probably null
R7165:Cntnap5b UTSW 1 100076162 missense possibly damaging 0.94
R7190:Cntnap5b UTSW 1 100431849 splice site probably null
R7376:Cntnap5b UTSW 1 99967269 missense possibly damaging 0.92
R7385:Cntnap5b UTSW 1 100379090 missense probably damaging 1.00
R8053:Cntnap5b UTSW 1 100390677 missense probably damaging 0.98
R8080:Cntnap5b UTSW 1 100072203 missense probably benign 0.16
R8082:Cntnap5b UTSW 1 100379216 missense probably benign 0.00
R8271:Cntnap5b UTSW 1 100072107 missense probably benign 0.00
R8303:Cntnap5b UTSW 1 100141297 missense probably damaging 1.00
R8428:Cntnap5b UTSW 1 100383585 missense probably damaging 0.98
RF007:Cntnap5b UTSW 1 100164070 missense probably damaging 1.00
X0020:Cntnap5b UTSW 1 100431848 critical splice donor site probably null
Z1176:Cntnap5b UTSW 1 99967270 missense probably damaging 0.99
Z1176:Cntnap5b UTSW 1 100164228 missense possibly damaging 0.86
Z1176:Cntnap5b UTSW 1 100446840 missense probably benign 0.01
Z1177:Cntnap5b UTSW 1 100050706 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GACTCTTAATGGTTTCATTTATCAGCC -3'
(R):5'- GGCATTTCTCAACCTCAATGTAC -3'

Sequencing Primer
(F):5'- AGAAGAGAGACTATATGTACACACAC -3'
(R):5'- ACATGGTGGCTTACAACCATCTG -3'
Posted On2014-09-17