Incidental Mutation 'R2069:Tlk2'
ID226969
Institutional Source Beutler Lab
Gene Symbol Tlk2
Ensembl Gene ENSMUSG00000020694
Gene Nametousled-like kinase 2 (Arabidopsis)
Synonymsprotein kinase U-alpha, 4933403M19Rik, PKUalpha
MMRRC Submission 040074-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.747) question?
Stock #R2069 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location105178807-105283959 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105240440 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 204 (Q204L)
Ref Sequence ENSEMBL: ENSMUSP00000090198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015107] [ENSMUST00000092537] [ENSMUST00000106939] [ENSMUST00000106941] [ENSMUST00000126175] [ENSMUST00000145048]
Predicted Effect probably benign
Transcript: ENSMUST00000015107
AA Change: Q172L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000015107
Gene: ENSMUSG00000020694
AA Change: Q172L

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092537
AA Change: Q204L

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000090198
Gene: ENSMUSG00000020694
AA Change: Q204L

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
Pfam:Pkinase 440 675 9.4e-52 PFAM
Pfam:Pkinase_Tyr 441 669 3.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106939
AA Change: Q172L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102552
Gene: ENSMUSG00000020694
AA Change: Q172L

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 202 237 N/A INTRINSIC
coiled coil region 285 314 N/A INTRINSIC
coiled coil region 355 393 N/A INTRINSIC
S_TKc 408 687 1.63e-78 SMART
low complexity region 696 717 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106941
AA Change: Q204L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102554
Gene: ENSMUSG00000020694
AA Change: Q204L

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
coiled coil region 234 269 N/A INTRINSIC
coiled coil region 317 346 N/A INTRINSIC
coiled coil region 387 425 N/A INTRINSIC
S_TKc 440 719 1.63e-78 SMART
low complexity region 728 749 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123050
Predicted Effect probably benign
Transcript: ENSMUST00000126175
SMART Domains Protein: ENSMUSP00000120944
Gene: ENSMUSG00000020694

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145048
SMART Domains Protein: ENSMUSP00000118520
Gene: ENSMUSG00000020694

DomainStartEndE-ValueType
low complexity region 55 66 N/A INTRINSIC
low complexity region 102 113 N/A INTRINSIC
coiled coil region 170 205 N/A INTRINSIC
coiled coil region 253 282 N/A INTRINSIC
coiled coil region 323 361 N/A INTRINSIC
Pfam:Pkinase 376 611 2.4e-51 PFAM
Pfam:Pkinase_Tyr 377 605 8.5e-32 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000152404
AA Change: Q152L
SMART Domains Protein: ENSMUSP00000123179
Gene: ENSMUSG00000020694
AA Change: Q152L

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
low complexity region 41 55 N/A INTRINSIC
low complexity region 83 94 N/A INTRINSIC
Meta Mutation Damage Score 0.0746 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear serine/threonine kinase that was first identified in Arabidopsis. The encoded protein is thought to function in the regulation of chromatin assembly in the S phase of the cell cycle by regulating the levels of a histone H3/H4 chaperone. This protein is associated with double-strand break repair of DNA damage caused by radiation. Pseudogenes of this gene are present on chromosomes 10 and 17. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,874,280 V86A probably benign Het
Abcc3 A T 11: 94,364,417 I601N probably damaging Het
Abl2 T A 1: 156,620,827 probably null Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ahi1 C T 10: 20,959,996 T76I probably damaging Het
Arhgap42 C T 9: 9,035,600 G247D probably damaging Het
Arid2 C T 15: 96,362,590 L407F probably damaging Het
Atp13a1 T C 8: 69,799,773 F606L probably benign Het
Avl9 T A 6: 56,736,435 probably benign Het
B3glct C T 5: 149,709,380 A65V probably damaging Het
Bcorl1 T C X: 48,401,917 probably benign Het
Bdp1 T C 13: 100,050,988 T1624A probably benign Het
Bmp15 A G X: 6,316,021 M263T probably benign Het
Brd8 T C 18: 34,614,479 K110E probably damaging Het
Cachd1 A G 4: 100,990,844 D1052G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc113 G A 8: 95,557,296 E333K probably benign Het
Ccnl2 A T 4: 155,812,481 probably null Het
Ccr9 T C 9: 123,779,364 F37S probably benign Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Ceacam10 A T 7: 24,778,372 N104I probably damaging Het
Cenpk T A 13: 104,236,176 probably benign Het
Cfi A G 3: 129,858,804 probably null Het
Chd1 T C 17: 15,742,294 F771S probably damaging Het
Chil4 G A 3: 106,219,455 L4F probably benign Het
Cilp G A 9: 65,278,090 R489Q possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Coq8b A G 7: 27,257,377 E485G probably damaging Het
Cse1l A G 2: 166,941,492 S733G probably benign Het
Dnah5 G A 15: 28,312,388 probably null Het
Dnmt3l T C 10: 78,052,732 V156A probably damaging Het
Duox1 A T 2: 122,333,062 T792S probably benign Het
Duox2 T C 2: 122,287,108 D915G probably benign Het
Efcab5 A T 11: 77,172,321 M115K probably benign Het
Eif2s1 G A 12: 78,877,185 D139N probably benign Het
Erg A G 16: 95,361,078 F390L probably damaging Het
Fam193b A T 13: 55,542,998 S650R probably damaging Het
Fbp2 T A 13: 62,854,061 K113N possibly damaging Het
Fnbp4 T G 2: 90,758,372 S496A probably damaging Het
Gab3 C A X: 75,000,095 R475L probably damaging Het
Gm7534 T G 4: 134,201,941 N351T possibly damaging Het
Gsap T C 5: 21,226,839 probably benign Het
Gucy1a2 C T 9: 3,582,697 L160F probably damaging Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Hrasls5 T C 19: 7,612,638 S10P possibly damaging Het
Insc G T 7: 114,804,593 probably null Het
Jph2 A G 2: 163,339,685 S520P possibly damaging Het
Kidins220 T A 12: 24,987,006 probably benign Het
Krtap29-1 A G 11: 99,978,612 S148P probably damaging Het
Ltbp2 A C 12: 84,793,733 C1000G probably damaging Het
Map2k3 T C 11: 60,950,027 F294S probably damaging Het
Map4k2 C A 19: 6,342,738 probably benign Het
Mboat2 T C 12: 24,951,443 V281A probably benign Het
Mdga2 G A 12: 66,568,917 R570* probably null Het
Mlxipl A G 5: 135,107,005 D28G probably damaging Het
Morc2b T C 17: 33,136,760 I679M probably benign Het
Myh4 T C 11: 67,246,366 probably benign Het
Nfib A C 4: 82,498,615 L61R probably damaging Het
Noc2l C A 4: 156,241,450 Y227* probably null Het
Nrde2 A G 12: 100,142,232 S367P probably damaging Het
Nup93 C A 8: 94,243,739 P89T probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1283 A G 2: 111,369,095 I154M probably benign Het
Olfr6 A T 7: 106,956,287 Y216* probably null Het
Olfr714 A T 7: 107,074,619 K264* probably null Het
Olfr749 T A 14: 50,736,576 E195D possibly damaging Het
Olfr824 A G 10: 130,126,205 I284T possibly damaging Het
Oxct1 G T 15: 4,092,525 A319S probably null Het
P2ry10 A G X: 107,103,253 S265G probably benign Het
Peak1 A T 9: 56,258,759 N628K probably damaging Het
Pkdrej T A 15: 85,821,231 Q168L probably benign Het
Plec A G 15: 76,188,926 M604T probably benign Het
Pmfbp1 A T 8: 109,532,103 N680I possibly damaging Het
Pnmal2 T C 7: 16,945,789 W233R probably damaging Het
Pxn A G 5: 115,545,667 N186S probably benign Het
Rsad1 A C 11: 94,549,125 probably benign Het
Runx2 A G 17: 44,735,342 I112T probably benign Het
S1pr2 A T 9: 20,967,494 L346Q probably damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Slc36a4 T A 9: 15,726,980 F234Y probably damaging Het
Slitrk2 T A X: 66,654,629 V242D probably damaging Het
Sp100 A G 1: 85,681,142 probably null Het
Spryd3 A C 15: 102,118,181 L352V probably benign Het
Ssc4d A C 5: 135,970,317 W11G possibly damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tnfrsf21 A T 17: 43,037,938 H147L possibly damaging Het
Tnrc18 A T 5: 142,766,087 D1154E unknown Het
Trap1 A G 16: 4,068,336 S86P probably benign Het
Trim32 T A 4: 65,614,776 C523* probably null Het
Ttc38 G T 15: 85,838,788 D146Y probably damaging Het
Ttc9 T A 12: 81,631,796 L131Q probably damaging Het
Ttn T C 2: 76,726,848 probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubash3b G A 9: 41,043,573 P92S possibly damaging Het
Ube4a T C 9: 44,948,099 N367S probably damaging Het
Ubr4 T A 4: 139,479,540 H4899Q possibly damaging Het
Ufl1 C T 4: 25,269,036 G265D possibly damaging Het
Vmn2r27 T A 6: 124,224,483 I172F probably damaging Het
Vmn2r6 A T 3: 64,556,098 H438Q possibly damaging Het
Vmn2r61 A G 7: 42,300,001 D615G probably benign Het
Wdr24 T A 17: 25,826,282 D330E probably damaging Het
Zbbx A T 3: 75,078,412 N444K probably benign Het
Zc3h7b A T 15: 81,792,328 Q757L probably damaging Het
Other mutations in Tlk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Tlk2 APN 11 105246795 nonsense probably null
IGL00956:Tlk2 APN 11 105247592 missense probably benign 0.01
IGL01083:Tlk2 APN 11 105221224 missense probably benign 0.11
IGL02523:Tlk2 APN 11 105275947 missense probably damaging 0.99
IGL02694:Tlk2 APN 11 105221235 missense probably benign 0.19
H8786:Tlk2 UTSW 11 105254979 missense possibly damaging 0.93
PIT4378001:Tlk2 UTSW 11 105281220 missense unknown
R0310:Tlk2 UTSW 11 105254973 missense probably benign 0.15
R1457:Tlk2 UTSW 11 105256952 critical splice donor site probably null
R1505:Tlk2 UTSW 11 105260295 missense probably damaging 1.00
R1856:Tlk2 UTSW 11 105221298 missense probably benign 0.00
R2305:Tlk2 UTSW 11 105241591 missense possibly damaging 0.47
R2351:Tlk2 UTSW 11 105209830 missense probably damaging 1.00
R3724:Tlk2 UTSW 11 105247564 missense probably benign 0.01
R4607:Tlk2 UTSW 11 105255018 missense probably damaging 1.00
R4641:Tlk2 UTSW 11 105275983 missense probably benign 0.41
R4738:Tlk2 UTSW 11 105256882 missense probably benign 0.22
R4803:Tlk2 UTSW 11 105281100 missense probably damaging 1.00
R4957:Tlk2 UTSW 11 105253359 critical splice donor site probably null
R5407:Tlk2 UTSW 11 105240375 missense probably damaging 0.98
R5551:Tlk2 UTSW 11 105221307 missense probably benign 0.05
R6456:Tlk2 UTSW 11 105221273 missense probably benign 0.05
R6922:Tlk2 UTSW 11 105256953 critical splice donor site probably null
R7183:Tlk2 UTSW 11 105221359 splice site probably null
R7265:Tlk2 UTSW 11 105184244 nonsense probably null
R7760:Tlk2 UTSW 11 105279167 missense probably damaging 1.00
R7797:Tlk2 UTSW 11 105210618 missense probably benign 0.00
R7823:Tlk2 UTSW 11 105253307 missense probably damaging 1.00
R8786:Tlk2 UTSW 11 105281233 missense unknown
Z1177:Tlk2 UTSW 11 105184290 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GAAGGTACCATATCCAGCTTTTG -3'
(R):5'- TCTTCATACCATGCTGCAGC -3'

Sequencing Primer
(F):5'- TGGTCTTGACTTCTGACTATCATTAG -3'
(R):5'- ATCATGCCTACCACAACAGTAAAG -3'
Posted On2014-09-17