Incidental Mutation 'R2069:Mdga2'
ID226972
Institutional Source Beutler Lab
Gene Symbol Mdga2
Ensembl Gene ENSMUSG00000034912
Gene NameMAM domain containing glycosylphosphatidylinositol anchor 2
SynonymsAdp, 6720489L24Rik, Mamdc1, 9330209L04Rik, Mdga2
MMRRC Submission 040074-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2069 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location66466060-67222549 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 66568917 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 570 (R570*)
Ref Sequence ENSEMBL: ENSMUSP00000152613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037181] [ENSMUST00000222167] [ENSMUST00000223141]
Predicted Effect probably null
Transcript: ENSMUST00000037181
AA Change: R639*
SMART Domains Protein: ENSMUSP00000046761
Gene: ENSMUSG00000034912
AA Change: R639*

DomainStartEndE-ValueType
IGc2 122 186 1.38e-15 SMART
IG 213 307 1.79e0 SMART
IGc2 324 386 1.56e-14 SMART
IGc2 419 493 4.43e-5 SMART
low complexity region 495 507 N/A INTRINSIC
IGc2 525 591 1.97e-11 SMART
IG_like 621 687 2.5e0 SMART
Blast:FN3 707 795 4e-40 BLAST
MAM 812 990 3.4e-49 SMART
transmembrane domain 999 1021 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101379
SMART Domains Protein: ENSMUSP00000098930
Gene: ENSMUSG00000034912

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SCOP:d1cs6a1 40 72 2e-5 SMART
Blast:IG 47 72 9e-11 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000178814
AA Change: R629*
SMART Domains Protein: ENSMUSP00000137608
Gene: ENSMUSG00000034912
AA Change: R629*

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IGc2 53 117 1.38e-15 SMART
IG 144 238 1.79e0 SMART
IGc2 255 317 1.56e-14 SMART
IGc2 350 424 4.43e-5 SMART
low complexity region 426 438 N/A INTRINSIC
IGc2 456 522 1.97e-11 SMART
IG_like 552 618 2.5e0 SMART
Blast:FN3 638 726 3e-40 BLAST
MAM 736 914 1.38e-49 SMART
transmembrane domain 923 945 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000222167
AA Change: R570*
Predicted Effect probably null
Transcript: ENSMUST00000223141
AA Change: R570*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223289
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (104/104)
MGI Phenotype PHENOTYPE: Mice that paternally inherit an allele disrupted by transgene insertion exhibit varying degrees of abnormalities in the skull, paw, and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,874,280 V86A probably benign Het
Abcc3 A T 11: 94,364,417 I601N probably damaging Het
Abl2 T A 1: 156,620,827 probably null Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ahi1 C T 10: 20,959,996 T76I probably damaging Het
Arhgap42 C T 9: 9,035,600 G247D probably damaging Het
Arid2 C T 15: 96,362,590 L407F probably damaging Het
Atp13a1 T C 8: 69,799,773 F606L probably benign Het
Avl9 T A 6: 56,736,435 probably benign Het
B3glct C T 5: 149,709,380 A65V probably damaging Het
Bcorl1 T C X: 48,401,917 probably benign Het
Bdp1 T C 13: 100,050,988 T1624A probably benign Het
Bmp15 A G X: 6,316,021 M263T probably benign Het
Brd8 T C 18: 34,614,479 K110E probably damaging Het
Cachd1 A G 4: 100,990,844 D1052G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc113 G A 8: 95,557,296 E333K probably benign Het
Ccnl2 A T 4: 155,812,481 probably null Het
Ccr9 T C 9: 123,779,364 F37S probably benign Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Ceacam10 A T 7: 24,778,372 N104I probably damaging Het
Cenpk T A 13: 104,236,176 probably benign Het
Cfi A G 3: 129,858,804 probably null Het
Chd1 T C 17: 15,742,294 F771S probably damaging Het
Chil4 G A 3: 106,219,455 L4F probably benign Het
Cilp G A 9: 65,278,090 R489Q possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Coq8b A G 7: 27,257,377 E485G probably damaging Het
Cse1l A G 2: 166,941,492 S733G probably benign Het
Dnah5 G A 15: 28,312,388 probably null Het
Dnmt3l T C 10: 78,052,732 V156A probably damaging Het
Duox1 A T 2: 122,333,062 T792S probably benign Het
Duox2 T C 2: 122,287,108 D915G probably benign Het
Efcab5 A T 11: 77,172,321 M115K probably benign Het
Eif2s1 G A 12: 78,877,185 D139N probably benign Het
Erg A G 16: 95,361,078 F390L probably damaging Het
Fam193b A T 13: 55,542,998 S650R probably damaging Het
Fbp2 T A 13: 62,854,061 K113N possibly damaging Het
Fnbp4 T G 2: 90,758,372 S496A probably damaging Het
Gab3 C A X: 75,000,095 R475L probably damaging Het
Gm7534 T G 4: 134,201,941 N351T possibly damaging Het
Gsap T C 5: 21,226,839 probably benign Het
Gucy1a2 C T 9: 3,582,697 L160F probably damaging Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Hrasls5 T C 19: 7,612,638 S10P possibly damaging Het
Insc G T 7: 114,804,593 probably null Het
Jph2 A G 2: 163,339,685 S520P possibly damaging Het
Kidins220 T A 12: 24,987,006 probably benign Het
Krtap29-1 A G 11: 99,978,612 S148P probably damaging Het
Ltbp2 A C 12: 84,793,733 C1000G probably damaging Het
Map2k3 T C 11: 60,950,027 F294S probably damaging Het
Map4k2 C A 19: 6,342,738 probably benign Het
Mboat2 T C 12: 24,951,443 V281A probably benign Het
Mlxipl A G 5: 135,107,005 D28G probably damaging Het
Morc2b T C 17: 33,136,760 I679M probably benign Het
Myh4 T C 11: 67,246,366 probably benign Het
Nfib A C 4: 82,498,615 L61R probably damaging Het
Noc2l C A 4: 156,241,450 Y227* probably null Het
Nrde2 A G 12: 100,142,232 S367P probably damaging Het
Nup93 C A 8: 94,243,739 P89T probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1283 A G 2: 111,369,095 I154M probably benign Het
Olfr6 A T 7: 106,956,287 Y216* probably null Het
Olfr714 A T 7: 107,074,619 K264* probably null Het
Olfr749 T A 14: 50,736,576 E195D possibly damaging Het
Olfr824 A G 10: 130,126,205 I284T possibly damaging Het
Oxct1 G T 15: 4,092,525 A319S probably null Het
P2ry10 A G X: 107,103,253 S265G probably benign Het
Peak1 A T 9: 56,258,759 N628K probably damaging Het
Pkdrej T A 15: 85,821,231 Q168L probably benign Het
Plec A G 15: 76,188,926 M604T probably benign Het
Pmfbp1 A T 8: 109,532,103 N680I possibly damaging Het
Pnmal2 T C 7: 16,945,789 W233R probably damaging Het
Pxn A G 5: 115,545,667 N186S probably benign Het
Rsad1 A C 11: 94,549,125 probably benign Het
Runx2 A G 17: 44,735,342 I112T probably benign Het
S1pr2 A T 9: 20,967,494 L346Q probably damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Slc36a4 T A 9: 15,726,980 F234Y probably damaging Het
Slitrk2 T A X: 66,654,629 V242D probably damaging Het
Sp100 A G 1: 85,681,142 probably null Het
Spryd3 A C 15: 102,118,181 L352V probably benign Het
Ssc4d A C 5: 135,970,317 W11G possibly damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tlk2 A T 11: 105,240,440 Q204L probably benign Het
Tnfrsf21 A T 17: 43,037,938 H147L possibly damaging Het
Tnrc18 A T 5: 142,766,087 D1154E unknown Het
Trap1 A G 16: 4,068,336 S86P probably benign Het
Trim32 T A 4: 65,614,776 C523* probably null Het
Ttc38 G T 15: 85,838,788 D146Y probably damaging Het
Ttc9 T A 12: 81,631,796 L131Q probably damaging Het
Ttn T C 2: 76,726,848 probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubash3b G A 9: 41,043,573 P92S possibly damaging Het
Ube4a T C 9: 44,948,099 N367S probably damaging Het
Ubr4 T A 4: 139,479,540 H4899Q possibly damaging Het
Ufl1 C T 4: 25,269,036 G265D possibly damaging Het
Vmn2r27 T A 6: 124,224,483 I172F probably damaging Het
Vmn2r6 A T 3: 64,556,098 H438Q possibly damaging Het
Vmn2r61 A G 7: 42,300,001 D615G probably benign Het
Wdr24 T A 17: 25,826,282 D330E probably damaging Het
Zbbx A T 3: 75,078,412 N444K probably benign Het
Zc3h7b A T 15: 81,792,328 Q757L probably damaging Het
Other mutations in Mdga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Mdga2 APN 12 66723109 missense probably damaging 0.97
IGL01632:Mdga2 APN 12 66629898 splice site probably benign
IGL01843:Mdga2 APN 12 66723131 critical splice acceptor site probably null
IGL02230:Mdga2 APN 12 66655423 nonsense probably null
IGL02348:Mdga2 APN 12 66550575 missense probably damaging 1.00
IGL02473:Mdga2 APN 12 66550611 missense possibly damaging 0.73
IGL02795:Mdga2 APN 12 66689432 missense probably benign 0.00
IGL02901:Mdga2 APN 12 66797809 splice site probably benign
IGL03373:Mdga2 APN 12 66716722 missense probably damaging 0.99
PIT4362001:Mdga2 UTSW 12 66797768 missense possibly damaging 0.83
PIT4377001:Mdga2 UTSW 12 66716695 missense probably damaging 0.99
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0106:Mdga2 UTSW 12 66716706 missense probably damaging 1.00
R0110:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0218:Mdga2 UTSW 12 66655120 missense probably damaging 1.00
R0450:Mdga2 UTSW 12 66470926 missense possibly damaging 0.66
R0801:Mdga2 UTSW 12 66486733 missense probably damaging 1.00
R0847:Mdga2 UTSW 12 66723080 missense probably damaging 1.00
R1056:Mdga2 UTSW 12 66723120 missense probably damaging 0.97
R1086:Mdga2 UTSW 12 66506102 splice site probably benign
R1335:Mdga2 UTSW 12 66716742 splice site probably null
R1382:Mdga2 UTSW 12 66470916 missense possibly damaging 0.68
R1490:Mdga2 UTSW 12 66797756 missense probably benign 0.01
R1521:Mdga2 UTSW 12 66568926 missense probably benign 0.00
R1556:Mdga2 UTSW 12 66550593 missense possibly damaging 0.92
R1676:Mdga2 UTSW 12 66568772 missense probably damaging 1.00
R1676:Mdga2 UTSW 12 66568773 nonsense probably null
R1698:Mdga2 UTSW 12 66689335 missense probably damaging 0.97
R1954:Mdga2 UTSW 12 66486708 splice site probably benign
R2077:Mdga2 UTSW 12 66655362 missense probably damaging 1.00
R2118:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
R2146:Mdga2 UTSW 12 66868741 missense probably damaging 1.00
R2158:Mdga2 UTSW 12 66689381 missense possibly damaging 0.64
R2189:Mdga2 UTSW 12 66473196 splice site probably null
R2293:Mdga2 UTSW 12 66568985 nonsense probably null
R2886:Mdga2 UTSW 12 66506270 splice site probably benign
R2960:Mdga2 UTSW 12 66629978 nonsense probably null
R3937:Mdga2 UTSW 12 67221206 unclassified probably benign
R4437:Mdga2 UTSW 12 66473198 splice site probably null
R4514:Mdga2 UTSW 12 66716722 missense probably damaging 0.99
R4693:Mdga2 UTSW 12 66797633 missense possibly damaging 0.81
R4719:Mdga2 UTSW 12 66471001 unclassified probably benign
R4744:Mdga2 UTSW 12 66797727 missense probably benign 0.01
R4756:Mdga2 UTSW 12 66797653 missense probably damaging 1.00
R4781:Mdga2 UTSW 12 66797622 splice site probably null
R5022:Mdga2 UTSW 12 66470760 missense possibly damaging 0.83
R5108:Mdga2 UTSW 12 66486741 missense probably benign 0.43
R5479:Mdga2 UTSW 12 66655176 missense probably damaging 1.00
R5710:Mdga2 UTSW 12 66506782 missense probably damaging 1.00
R5816:Mdga2 UTSW 12 66655182 missense probably damaging 1.00
R5822:Mdga2 UTSW 12 66655335 missense probably damaging 1.00
R5996:Mdga2 UTSW 12 66797763 missense probably benign 0.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6038:Mdga2 UTSW 12 66630053 missense probably damaging 1.00
R6297:Mdga2 UTSW 12 66506253 missense probably damaging 1.00
R6484:Mdga2 UTSW 12 66630069 missense possibly damaging 0.90
R6830:Mdga2 UTSW 12 66723001 missense probably damaging 1.00
R6912:Mdga2 UTSW 12 66506115 missense probably benign 0.01
R6971:Mdga2 UTSW 12 66550561 missense probably damaging 1.00
R7053:Mdga2 UTSW 12 66689384 missense probably benign 0.41
R7069:Mdga2 UTSW 12 66486752 missense probably benign 0.31
R7381:Mdga2 UTSW 12 66568896 missense probably benign 0.44
R7474:Mdga2 UTSW 12 66486761 nonsense probably null
R7559:Mdga2 UTSW 12 66473229 missense probably damaging 1.00
R7581:Mdga2 UTSW 12 66506255 missense probably damaging 0.99
R7596:Mdga2 UTSW 12 66506123 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689350 missense probably damaging 0.99
R7745:Mdga2 UTSW 12 66689351 missense possibly damaging 0.63
R7852:Mdga2 UTSW 12 66470950 missense possibly damaging 0.66
R8144:Mdga2 UTSW 12 66655263 missense probably damaging 1.00
R8319:Mdga2 UTSW 12 67221029 missense unknown
R8715:Mdga2 UTSW 12 66868752 missense probably damaging 1.00
Z1176:Mdga2 UTSW 12 66689443 missense probably damaging 1.00
Z1186:Mdga2 UTSW 12 66568953 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGAAAGCTGCATCTCCCTGC -3'
(R):5'- GGCTCAGTTTAAATATACTCTCCACC -3'

Sequencing Primer
(F):5'- CTGCTCCAGCTTCATTTATGATG -3'
(R):5'- TTAAAAATACGCCCTCTGCTGG -3'
Posted On2014-09-17