Incidental Mutation 'R2069:Pkdrej'
ID226988
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission 040074-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R2069 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85821231 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 168 (Q168L)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
Predicted Effect probably benign
Transcript: ENSMUST00000064370
AA Change: Q168L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: Q168L

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Meta Mutation Damage Score 0.1951 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (104/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T C 5: 114,874,280 V86A probably benign Het
Abcc3 A T 11: 94,364,417 I601N probably damaging Het
Abl2 T A 1: 156,620,827 probably null Het
Adgrf4 C T 17: 42,666,898 R518Q possibly damaging Het
Ahi1 C T 10: 20,959,996 T76I probably damaging Het
Arhgap42 C T 9: 9,035,600 G247D probably damaging Het
Arid2 C T 15: 96,362,590 L407F probably damaging Het
Atp13a1 T C 8: 69,799,773 F606L probably benign Het
Avl9 T A 6: 56,736,435 probably benign Het
B3glct C T 5: 149,709,380 A65V probably damaging Het
Bcorl1 T C X: 48,401,917 probably benign Het
Bdp1 T C 13: 100,050,988 T1624A probably benign Het
Bmp15 A G X: 6,316,021 M263T probably benign Het
Brd8 T C 18: 34,614,479 K110E probably damaging Het
Cachd1 A G 4: 100,990,844 D1052G probably damaging Het
Capn9 G A 8: 124,605,711 G430R possibly damaging Het
Ccdc113 G A 8: 95,557,296 E333K probably benign Het
Ccnl2 A T 4: 155,812,481 probably null Het
Ccr9 T C 9: 123,779,364 F37S probably benign Het
Cdh7 A T 1: 110,138,159 D721V probably damaging Het
Ceacam10 A T 7: 24,778,372 N104I probably damaging Het
Cenpk T A 13: 104,236,176 probably benign Het
Cfi A G 3: 129,858,804 probably null Het
Chd1 T C 17: 15,742,294 F771S probably damaging Het
Chil4 G A 3: 106,219,455 L4F probably benign Het
Cilp G A 9: 65,278,090 R489Q possibly damaging Het
Cntnap5b G A 1: 100,358,725 G402R probably benign Het
Coq8b A G 7: 27,257,377 E485G probably damaging Het
Cse1l A G 2: 166,941,492 S733G probably benign Het
Dnah5 G A 15: 28,312,388 probably null Het
Dnmt3l T C 10: 78,052,732 V156A probably damaging Het
Duox1 A T 2: 122,333,062 T792S probably benign Het
Duox2 T C 2: 122,287,108 D915G probably benign Het
Efcab5 A T 11: 77,172,321 M115K probably benign Het
Eif2s1 G A 12: 78,877,185 D139N probably benign Het
Erg A G 16: 95,361,078 F390L probably damaging Het
Fam193b A T 13: 55,542,998 S650R probably damaging Het
Fbp2 T A 13: 62,854,061 K113N possibly damaging Het
Fnbp4 T G 2: 90,758,372 S496A probably damaging Het
Gab3 C A X: 75,000,095 R475L probably damaging Het
Gm7534 T G 4: 134,201,941 N351T possibly damaging Het
Gsap T C 5: 21,226,839 probably benign Het
Gucy1a2 C T 9: 3,582,697 L160F probably damaging Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Hrasls5 T C 19: 7,612,638 S10P possibly damaging Het
Insc G T 7: 114,804,593 probably null Het
Jph2 A G 2: 163,339,685 S520P possibly damaging Het
Kidins220 T A 12: 24,987,006 probably benign Het
Krtap29-1 A G 11: 99,978,612 S148P probably damaging Het
Ltbp2 A C 12: 84,793,733 C1000G probably damaging Het
Map2k3 T C 11: 60,950,027 F294S probably damaging Het
Map4k2 C A 19: 6,342,738 probably benign Het
Mboat2 T C 12: 24,951,443 V281A probably benign Het
Mdga2 G A 12: 66,568,917 R570* probably null Het
Mlxipl A G 5: 135,107,005 D28G probably damaging Het
Morc2b T C 17: 33,136,760 I679M probably benign Het
Myh4 T C 11: 67,246,366 probably benign Het
Nfib A C 4: 82,498,615 L61R probably damaging Het
Noc2l C A 4: 156,241,450 Y227* probably null Het
Nrde2 A G 12: 100,142,232 S367P probably damaging Het
Nup93 C A 8: 94,243,739 P89T probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1240 C T 2: 89,439,583 R232H probably benign Het
Olfr1283 A G 2: 111,369,095 I154M probably benign Het
Olfr6 A T 7: 106,956,287 Y216* probably null Het
Olfr714 A T 7: 107,074,619 K264* probably null Het
Olfr749 T A 14: 50,736,576 E195D possibly damaging Het
Olfr824 A G 10: 130,126,205 I284T possibly damaging Het
Oxct1 G T 15: 4,092,525 A319S probably null Het
P2ry10 A G X: 107,103,253 S265G probably benign Het
Peak1 A T 9: 56,258,759 N628K probably damaging Het
Plec A G 15: 76,188,926 M604T probably benign Het
Pmfbp1 A T 8: 109,532,103 N680I possibly damaging Het
Pnmal2 T C 7: 16,945,789 W233R probably damaging Het
Pxn A G 5: 115,545,667 N186S probably benign Het
Rsad1 A C 11: 94,549,125 probably benign Het
Runx2 A G 17: 44,735,342 I112T probably benign Het
S1pr2 A T 9: 20,967,494 L346Q probably damaging Het
Skint6 A G 4: 113,238,132 I110T probably damaging Het
Slc36a4 T A 9: 15,726,980 F234Y probably damaging Het
Slitrk2 T A X: 66,654,629 V242D probably damaging Het
Sp100 A G 1: 85,681,142 probably null Het
Spryd3 A C 15: 102,118,181 L352V probably benign Het
Ssc4d A C 5: 135,970,317 W11G possibly damaging Het
Stx17 T A 4: 48,158,870 D83E probably damaging Het
Tlk2 A T 11: 105,240,440 Q204L probably benign Het
Tnfrsf21 A T 17: 43,037,938 H147L possibly damaging Het
Tnrc18 A T 5: 142,766,087 D1154E unknown Het
Trap1 A G 16: 4,068,336 S86P probably benign Het
Trim32 T A 4: 65,614,776 C523* probably null Het
Ttc38 G T 15: 85,838,788 D146Y probably damaging Het
Ttc9 T A 12: 81,631,796 L131Q probably damaging Het
Ttn T C 2: 76,726,848 probably benign Het
Ttn C T 2: 76,813,339 G11436R probably damaging Het
Ubash3b G A 9: 41,043,573 P92S possibly damaging Het
Ube4a T C 9: 44,948,099 N367S probably damaging Het
Ubr4 T A 4: 139,479,540 H4899Q possibly damaging Het
Ufl1 C T 4: 25,269,036 G265D possibly damaging Het
Vmn2r27 T A 6: 124,224,483 I172F probably damaging Het
Vmn2r6 A T 3: 64,556,098 H438Q possibly damaging Het
Vmn2r61 A G 7: 42,300,001 D615G probably benign Het
Wdr24 T A 17: 25,826,282 D330E probably damaging Het
Zbbx A T 3: 75,078,412 N444K probably benign Het
Zc3h7b A T 15: 81,792,328 Q757L probably damaging Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 unclassified probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R7956:Pkdrej UTSW 15 85816523 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GAGAACTTCACGGTTACTCTGGG -3'
(R):5'- TGCAGCCAGTGAAGATCAAC -3'

Sequencing Primer
(F):5'- TTACTCTGGGGGCTCCAAGAAG -3'
(R):5'- CAGGAAGGACCAGAACGCTC -3'
Posted On2014-09-17