Mutagenetix > Incidental Mutation

Incidental Mutation 'R2070:Ash1l'

227023

Institutional Source

Beutler Lab

Gene Symbol

Ash1l

Ensembl Gene

ENSMUSG00000028053

Gene Name

ASH1 like histone lysine methyltransferase

Synonyms

E430018P19Rik, 8030453L17Rik, KMT2H, chromatin remodeling factor

MMRRC Submission

040075-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2070 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

88857929-88986682 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 88873510 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Alanine at position 98 (P98A)

Ref Sequence

ENSEMBL: ENSMUSP00000140251 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000090933
AA Change: P98A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: P98A

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000178517

Predicted Effect

probably damaging
Transcript: ENSMUST00000186583
AA Change: P98A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: P98A

Domain	Start	End	E-Value	Type
low complexity region	36	46	N/A	INTRINSIC
low complexity region	226	237	N/A	INTRINSIC
internal_repeat_1	238	306	6.88e-12	PROSPERO
internal_repeat_1	306	406	6.88e-12	PROSPERO
low complexity region	552	571	N/A	INTRINSIC
low complexity region	706	717	N/A	INTRINSIC
low complexity region	745	753	N/A	INTRINSIC
low complexity region	777	791	N/A	INTRINSIC
AT_hook	823	835	3.06e2	SMART
low complexity region	859	873	N/A	INTRINSIC
AT_hook	885	897	9.15e0	SMART
low complexity region	938	948	N/A	INTRINSIC
low complexity region	1086	1105	N/A	INTRINSIC
low complexity region	1107	1121	N/A	INTRINSIC
low complexity region	1159	1173	N/A	INTRINSIC
low complexity region	1262	1273	N/A	INTRINSIC
low complexity region	1288	1301	N/A	INTRINSIC
AT_hook	1345	1357	3.09e-1	SMART
low complexity region	1377	1388	N/A	INTRINSIC
low complexity region	1395	1424	N/A	INTRINSIC
low complexity region	1478	1491	N/A	INTRINSIC
low complexity region	1678	1692	N/A	INTRINSIC
AT_hook	1843	1855	1.03e1	SMART
low complexity region	1971	1983	N/A	INTRINSIC
AWS	2081	2133	3.95e-26	SMART
SET	2135	2257	8.04e-45	SMART
PostSET	2259	2275	6.38e-2	SMART
low complexity region	2296	2316	N/A	INTRINSIC
BROMO	2431	2541	8.29e-23	SMART
low complexity region	2549	2563	N/A	INTRINSIC
PHD	2576	2618	8.25e-6	SMART
BAH	2650	2787	1.18e-23	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	A	G	11: 58,767,595 (GRCm39)	K31E	probably damaging	Het
Abcc10	G	C	17: 46,614,491 (GRCm39)	N1477K	probably benign	Het
Ablim2	G	A	5: 35,955,857 (GRCm39)	C24Y	probably damaging	Het
Ankle1	T	C	8: 71,861,988 (GRCm39)	F497S	probably damaging	Het
Armh3	G	T	19: 45,879,724 (GRCm39)	P543Q	probably damaging	Het
Atad5	A	T	11: 79,988,878 (GRCm39)		probably null	Het
B3gnt4	A	T	5: 123,649,433 (GRCm39)	H266L	probably benign	Het
Bmi1	A	G	2: 18,688,851 (GRCm39)	I207V	probably benign	Het
Bnip3l	A	G	14: 67,226,671 (GRCm39)	M174T	probably damaging	Het
Bora	T	C	14: 99,299,714 (GRCm39)	S229P	probably damaging	Het
Ccdc121	T	C	5: 31,644,727 (GRCm39)	V160A	possibly damaging	Het
Ccdc27	T	A	4: 154,126,270 (GRCm39)	N73I	unknown	Het
Cdc42bpg	T	A	19: 6,370,518 (GRCm39)	C1204S	probably damaging	Het
Cdsn	A	T	17: 35,865,591 (GRCm39)	D40V	probably damaging	Het
Cilp	T	A	9: 65,186,377 (GRCm39)	V824D	probably damaging	Het
Cmtr1	A	G	17: 29,913,757 (GRCm39)		probably null	Het
Cntnap1	A	G	11: 101,073,805 (GRCm39)	Y652C	probably damaging	Het
Col12a1	T	C	9: 79,554,978 (GRCm39)	I2033M	probably benign	Het
Cwh43	T	C	5: 73,578,860 (GRCm39)	L289P	probably damaging	Het
Ddhd1	T	C	14: 45,848,081 (GRCm39)	D529G	probably damaging	Het
Defb28	T	A	2: 152,362,064 (GRCm39)	S75T	probably benign	Het
Dennd2a	A	T	6: 39,442,053 (GRCm39)	V939D	probably damaging	Het
Dlg5	T	C	14: 24,186,703 (GRCm39)	R1866G	probably damaging	Het
Dsc1	C	T	18: 20,221,353 (GRCm39)		probably null	Het
Ecscr	T	G	18: 35,848,490 (GRCm39)	N184T	probably damaging	Het
Eif4ebp1	G	T	8: 27,763,372 (GRCm39)	R55L	probably damaging	Het
Eml1	G	T	12: 108,479,258 (GRCm39)	V344L	probably damaging	Het
Exoc2	G	T	13: 30,999,353 (GRCm39)	N901K	probably benign	Het
Fam161b	T	A	12: 84,403,202 (GRCm39)	I143F	probably benign	Het
Fam180a	A	G	6: 35,302,846 (GRCm39)	S2P	probably benign	Het
Fat3	T	A	9: 15,910,666 (GRCm39)	I1779F	probably benign	Het
Fat4	A	G	3: 39,064,804 (GRCm39)	K4920R	probably benign	Het
Fsip2	T	A	2: 82,806,699 (GRCm39)	V1006E	probably damaging	Het
Glcci1	A	G	6: 8,558,566 (GRCm39)	S30G	probably damaging	Het
Gm5414	A	T	15: 101,536,495 (GRCm39)	S43R	possibly damaging	Het
Hao1	T	C	2: 134,372,535 (GRCm39)	T158A	probably damaging	Het
Hic1	T	C	11: 75,059,885 (GRCm39)	H154R	possibly damaging	Het
Hmgxb3	T	C	18: 61,304,431 (GRCm39)	Y53C	probably damaging	Het
Ipmk	A	T	10: 71,208,579 (GRCm39)	K122*	probably null	Het
Jakmip2	T	C	18: 43,696,395 (GRCm39)	E518G	probably benign	Het
Kmt2e	A	G	5: 23,706,993 (GRCm39)	T1519A	probably benign	Het
Lfng	T	C	5: 140,598,350 (GRCm39)	I224T	possibly damaging	Het
Magel2	G	A	7: 62,028,844 (GRCm39)	V583I	unknown	Het
Map4k5	C	T	12: 69,863,111 (GRCm39)	V629I	probably damaging	Het
Med12l	A	G	3: 59,152,326 (GRCm39)	D1037G	probably damaging	Het
Morc1	C	T	16: 48,412,974 (GRCm39)	T705I	probably benign	Het
Mptx2	A	T	1: 173,102,145 (GRCm39)	Y181*	probably null	Het
Mrpl24	T	C	3: 87,830,374 (GRCm39)		probably null	Het
Myo5a	A	G	9: 75,089,266 (GRCm39)	E1132G	probably benign	Het
Nedd4l	T	G	18: 65,345,891 (GRCm39)	F814L	probably damaging	Het
Nmral1	T	A	16: 4,534,211 (GRCm39)	I77F	probably damaging	Het
Oit3	T	G	10: 59,266,835 (GRCm39)	I224L	probably benign	Het
Oxsm	A	G	14: 16,241,983 (GRCm38)	L262P	probably benign	Het
Pacs2	C	T	12: 113,024,731 (GRCm39)	T407I	probably damaging	Het
Pard6g	T	C	18: 80,160,940 (GRCm39)	I351T	probably benign	Het
Pdcl2	A	T	5: 76,472,838 (GRCm39)		probably null	Het
Pdzph1	T	C	17: 59,281,092 (GRCm39)	R397G	probably benign	Het
Phip	T	A	9: 82,757,352 (GRCm39)	I1607L	probably benign	Het
Plekhd1	C	A	12: 80,739,681 (GRCm39)	S10*	probably null	Het
Pramel24	T	G	4: 143,453,472 (GRCm39)	Y193*	probably null	Het
Prdm1	C	T	10: 44,317,408 (GRCm39)	D505N	possibly damaging	Het
Psmd13	T	C	7: 140,477,561 (GRCm39)	V320A	probably damaging	Het
Rbak	A	G	5: 143,162,339 (GRCm39)	L8P	probably damaging	Het
Rere	C	A	4: 150,699,047 (GRCm39)		probably benign	Het
Rint1	T	C	5: 24,015,927 (GRCm39)	S456P	possibly damaging	Het
Scn3a	T	C	2: 65,351,210 (GRCm39)	Q446R	possibly damaging	Het
Slitrk5	A	G	14: 111,917,621 (GRCm39)	Y415C	probably damaging	Het
Snrnp200	A	G	2: 127,054,323 (GRCm39)	E210G	possibly damaging	Het
Snrnp200	A	G	2: 127,079,803 (GRCm39)	T1891A	probably benign	Het
Sohlh2	A	G	3: 55,115,043 (GRCm39)	I343V	probably benign	Het
Spin1	T	C	13: 51,298,573 (GRCm39)		probably null	Het
St14	T	A	9: 31,002,669 (GRCm39)	I745F	probably damaging	Het
Sv2a	G	A	3: 96,101,191 (GRCm39)	A730T	possibly damaging	Het
Tars2	C	A	3: 95,654,950 (GRCm39)	G113C	probably damaging	Het
Tlcd3b	T	C	7: 126,419,012 (GRCm39)	L4P	probably benign	Het
Trp53	A	G	11: 69,480,458 (GRCm39)	D278G	probably damaging	Het
Ubxn7	T	A	16: 32,191,287 (GRCm39)	C160S	possibly damaging	Het
Uty	T	C	Y: 1,169,193 (GRCm39)	E414G	probably benign	Het
Wrap73	T	A	4: 154,233,200 (GRCm39)	S125T	possibly damaging	Het
Wwc2	T	C	8: 48,321,356 (GRCm39)	D586G	unknown	Het
Zfp106	T	C	2: 120,354,010 (GRCm39)	H1490R	probably benign	Het
Zswim5	T	C	4: 116,837,109 (GRCm39)	V731A	probably benign	Het
Zyg11b	G	C	4: 108,108,016 (GRCm39)	N463K	possibly damaging	Het

Other mutations in Ash1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ash1l	APN	3	88,889,019 (GRCm39)	missense	probably benign	0.19
IGL00819:Ash1l	APN	3	88,915,043 (GRCm39)	missense	possibly damaging	0.68
IGL00939:Ash1l	APN	3	88,942,543 (GRCm39)	missense	probably damaging	0.99
IGL01064:Ash1l	APN	3	88,979,791 (GRCm39)	missense	probably damaging	1.00
IGL01066:Ash1l	APN	3	88,891,942 (GRCm39)	missense	probably damaging	1.00
IGL01087:Ash1l	APN	3	88,971,209 (GRCm39)	missense	probably damaging	1.00
IGL01293:Ash1l	APN	3	88,890,836 (GRCm39)	missense	probably benign	0.01
IGL01541:Ash1l	APN	3	88,973,572 (GRCm39)	missense	probably damaging	1.00
IGL01863:Ash1l	APN	3	88,892,813 (GRCm39)	nonsense	probably null
IGL02326:Ash1l	APN	3	88,873,364 (GRCm39)	missense	probably benign	0.00
IGL02407:Ash1l	APN	3	88,979,855 (GRCm39)	missense	probably damaging	1.00
IGL02419:Ash1l	APN	3	88,892,872 (GRCm39)	missense	probably benign	0.00
IGL02422:Ash1l	APN	3	88,976,386 (GRCm39)	critical splice donor site	probably null
IGL02494:Ash1l	APN	3	88,973,525 (GRCm39)	nonsense	probably null
IGL02727:Ash1l	APN	3	88,930,344 (GRCm39)	missense	probably benign
IGL02732:Ash1l	APN	3	88,873,535 (GRCm39)	missense	probably damaging	1.00
IGL02817:Ash1l	APN	3	88,892,108 (GRCm39)	missense	probably damaging	1.00
IGL02887:Ash1l	APN	3	88,891,488 (GRCm39)	missense	probably benign	0.11
IGL03224:Ash1l	APN	3	88,942,575 (GRCm39)	splice site	probably benign
IGL03253:Ash1l	APN	3	88,891,981 (GRCm39)	missense	probably damaging	1.00
IGL03327:Ash1l	APN	3	88,930,390 (GRCm39)	missense	probably benign	0.02
IGL03398:Ash1l	APN	3	88,914,527 (GRCm39)	missense	probably benign	0.01
3-1:Ash1l	UTSW	3	88,873,633 (GRCm39)	missense	probably benign
BB008:Ash1l	UTSW	3	88,950,848 (GRCm39)	missense	probably damaging	1.00
BB018:Ash1l	UTSW	3	88,950,848 (GRCm39)	missense	probably damaging	1.00
R0068:Ash1l	UTSW	3	88,914,624 (GRCm39)	missense	probably benign	0.17
R0068:Ash1l	UTSW	3	88,914,624 (GRCm39)	missense	probably benign	0.17
R0239:Ash1l	UTSW	3	88,974,529 (GRCm39)	missense	possibly damaging	0.49
R0239:Ash1l	UTSW	3	88,974,529 (GRCm39)	missense	possibly damaging	0.49
R0395:Ash1l	UTSW	3	88,965,896 (GRCm39)	missense	probably damaging	1.00
R0477:Ash1l	UTSW	3	88,890,766 (GRCm39)	missense	probably benign	0.41
R0528:Ash1l	UTSW	3	88,889,584 (GRCm39)	missense	probably benign
R0543:Ash1l	UTSW	3	88,971,085 (GRCm39)	splice site	probably null
R0855:Ash1l	UTSW	3	88,961,761 (GRCm39)	missense	possibly damaging	0.82
R1147:Ash1l	UTSW	3	88,892,194 (GRCm39)	missense	possibly damaging	0.72
R1147:Ash1l	UTSW	3	88,892,194 (GRCm39)	missense	possibly damaging	0.72
R1163:Ash1l	UTSW	3	88,942,570 (GRCm39)	critical splice donor site	probably null
R1196:Ash1l	UTSW	3	88,890,623 (GRCm39)	missense	probably damaging	0.99
R1419:Ash1l	UTSW	3	88,892,204 (GRCm39)	missense	probably damaging	0.99
R1445:Ash1l	UTSW	3	88,914,659 (GRCm39)	missense	probably benign	0.02
R1466:Ash1l	UTSW	3	88,959,372 (GRCm39)	missense	probably damaging	1.00
R1466:Ash1l	UTSW	3	88,959,372 (GRCm39)	missense	probably damaging	1.00
R1480:Ash1l	UTSW	3	88,892,359 (GRCm39)	missense	probably damaging	1.00
R1506:Ash1l	UTSW	3	88,965,806 (GRCm39)	missense	probably damaging	0.99
R1537:Ash1l	UTSW	3	88,979,783 (GRCm39)	missense	probably damaging	0.99
R1584:Ash1l	UTSW	3	88,959,372 (GRCm39)	missense	probably damaging	1.00
R1669:Ash1l	UTSW	3	88,974,549 (GRCm39)	critical splice donor site	probably null
R1713:Ash1l	UTSW	3	88,983,531 (GRCm39)	missense	probably damaging	1.00
R1780:Ash1l	UTSW	3	88,873,291 (GRCm39)	missense	probably benign
R1793:Ash1l	UTSW	3	88,977,616 (GRCm39)	missense	probably damaging	1.00
R1881:Ash1l	UTSW	3	88,888,862 (GRCm39)	missense	probably benign	0.00
R1909:Ash1l	UTSW	3	88,891,835 (GRCm39)	missense	probably benign	0.29
R1938:Ash1l	UTSW	3	88,891,729 (GRCm39)	missense	probably damaging	0.98
R2035:Ash1l	UTSW	3	88,973,624 (GRCm39)	missense	probably benign	0.00
R2071:Ash1l	UTSW	3	88,873,510 (GRCm39)	missense	probably damaging	1.00
R2114:Ash1l	UTSW	3	88,890,571 (GRCm39)	missense	probably benign	0.00
R2116:Ash1l	UTSW	3	88,890,571 (GRCm39)	missense	probably benign	0.00
R2118:Ash1l	UTSW	3	88,892,602 (GRCm39)	missense	possibly damaging	0.80
R2143:Ash1l	UTSW	3	88,892,726 (GRCm39)	missense	probably benign	0.09
R2164:Ash1l	UTSW	3	88,892,726 (GRCm39)	missense	probably benign	0.09
R2210:Ash1l	UTSW	3	88,973,605 (GRCm39)	missense	probably damaging	1.00
R2247:Ash1l	UTSW	3	88,914,674 (GRCm39)	missense	possibly damaging	0.77
R2303:Ash1l	UTSW	3	88,933,733 (GRCm39)	missense	probably damaging	1.00
R2860:Ash1l	UTSW	3	88,961,785 (GRCm39)	missense	probably damaging	1.00
R2861:Ash1l	UTSW	3	88,961,785 (GRCm39)	missense	probably damaging	1.00
R3104:Ash1l	UTSW	3	88,961,693 (GRCm39)	missense	probably damaging	1.00
R4133:Ash1l	UTSW	3	88,889,567 (GRCm39)	missense	probably benign	0.00
R4164:Ash1l	UTSW	3	88,889,273 (GRCm39)	missense	probably damaging	0.97
R4270:Ash1l	UTSW	3	88,889,347 (GRCm39)	missense	probably benign	0.26
R4271:Ash1l	UTSW	3	88,889,347 (GRCm39)	missense	probably benign	0.26
R4287:Ash1l	UTSW	3	88,973,722 (GRCm39)	missense	probably damaging	0.99
R4409:Ash1l	UTSW	3	88,914,506 (GRCm39)	missense	probably damaging	0.99
R4459:Ash1l	UTSW	3	88,873,541 (GRCm39)	missense	probably damaging	0.99
R4487:Ash1l	UTSW	3	88,892,622 (GRCm39)	missense	possibly damaging	0.65
R4674:Ash1l	UTSW	3	88,979,783 (GRCm39)	missense	possibly damaging	0.80
R4739:Ash1l	UTSW	3	88,890,152 (GRCm39)	missense	probably benign	0.19
R4927:Ash1l	UTSW	3	88,892,641 (GRCm39)	missense	probably damaging	1.00
R5000:Ash1l	UTSW	3	88,965,941 (GRCm39)	missense	probably damaging	1.00
R5016:Ash1l	UTSW	3	88,889,630 (GRCm39)	missense	probably damaging	1.00
R5055:Ash1l	UTSW	3	88,930,519 (GRCm39)	critical splice donor site	probably null
R5081:Ash1l	UTSW	3	88,892,024 (GRCm39)	missense	probably damaging	1.00
R5082:Ash1l	UTSW	3	88,873,541 (GRCm39)	missense	probably damaging	0.99
R5090:Ash1l	UTSW	3	88,960,184 (GRCm39)	missense	probably damaging	1.00
R5113:Ash1l	UTSW	3	88,973,582 (GRCm39)	missense	probably damaging	0.99
R5408:Ash1l	UTSW	3	88,889,701 (GRCm39)	missense	probably damaging	1.00
R5452:Ash1l	UTSW	3	88,892,183 (GRCm39)	missense	possibly damaging	0.93
R5487:Ash1l	UTSW	3	88,888,733 (GRCm39)	missense	probably benign	0.17
R5610:Ash1l	UTSW	3	88,930,492 (GRCm39)	missense	probably damaging	1.00
R5624:Ash1l	UTSW	3	88,892,916 (GRCm39)	missense	probably damaging	1.00
R5682:Ash1l	UTSW	3	88,914,914 (GRCm39)	missense	probably damaging	0.99
R5712:Ash1l	UTSW	3	88,959,297 (GRCm39)	missense	probably damaging	0.99
R5719:Ash1l	UTSW	3	88,965,933 (GRCm39)	missense	probably damaging	1.00
R5719:Ash1l	UTSW	3	88,961,805 (GRCm39)	missense	possibly damaging	0.83
R5839:Ash1l	UTSW	3	88,890,658 (GRCm39)	missense	probably damaging	0.99
R5859:Ash1l	UTSW	3	88,976,300 (GRCm39)	missense	probably damaging	1.00
R5877:Ash1l	UTSW	3	88,888,891 (GRCm39)	missense	probably benign	0.00
R5940:Ash1l	UTSW	3	88,891,343 (GRCm39)	missense	probably damaging	0.96
R6026:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6027:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6029:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6033:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6034:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6035:Ash1l	UTSW	3	88,892,326 (GRCm39)	missense	probably damaging	1.00
R6089:Ash1l	UTSW	3	88,960,450 (GRCm39)	nonsense	probably null
R6110:Ash1l	UTSW	3	88,892,436 (GRCm39)	missense	probably damaging	1.00
R6168:Ash1l	UTSW	3	88,960,080 (GRCm39)	nonsense	probably null
R6200:Ash1l	UTSW	3	88,977,834 (GRCm39)	missense	probably damaging	1.00
R6290:Ash1l	UTSW	3	88,890,068 (GRCm39)	nonsense	probably null
R6331:Ash1l	UTSW	3	88,915,172 (GRCm39)	missense	probably benign	0.00
R6425:Ash1l	UTSW	3	88,891,087 (GRCm39)	missense	probably damaging	0.99
R6540:Ash1l	UTSW	3	88,892,368 (GRCm39)	missense	probably damaging	1.00
R6568:Ash1l	UTSW	3	88,959,344 (GRCm39)	missense	probably benign	0.09
R6828:Ash1l	UTSW	3	88,983,420 (GRCm39)	missense	probably benign	0.00
R6843:Ash1l	UTSW	3	88,892,695 (GRCm39)	missense	probably damaging	1.00
R6894:Ash1l	UTSW	3	88,890,298 (GRCm39)	missense	probably benign	0.00
R6976:Ash1l	UTSW	3	88,888,964 (GRCm39)	missense	possibly damaging	0.77
R7038:Ash1l	UTSW	3	88,889,978 (GRCm39)	missense	probably benign	0.00
R7073:Ash1l	UTSW	3	88,892,647 (GRCm39)	missense	probably damaging	1.00
R7133:Ash1l	UTSW	3	88,890,764 (GRCm39)	frame shift	probably null
R7150:Ash1l	UTSW	3	88,984,381 (GRCm39)	missense	probably damaging	1.00
R7205:Ash1l	UTSW	3	88,873,259 (GRCm39)	missense	probably benign	0.00
R7254:Ash1l	UTSW	3	88,977,816 (GRCm39)	missense	probably damaging	1.00
R7272:Ash1l	UTSW	3	88,961,941 (GRCm39)	splice site	probably null
R7288:Ash1l	UTSW	3	88,873,199 (GRCm39)	start gained	probably benign
R7319:Ash1l	UTSW	3	88,888,694 (GRCm39)	missense	probably benign	0.19
R7341:Ash1l	UTSW	3	88,889,066 (GRCm39)	missense	possibly damaging	0.93
R7342:Ash1l	UTSW	3	88,873,304 (GRCm39)	missense	possibly damaging	0.94
R7454:Ash1l	UTSW	3	88,891,172 (GRCm39)	missense	probably benign	0.16
R7677:Ash1l	UTSW	3	88,950,500 (GRCm39)	missense	probably damaging	1.00
R7822:Ash1l	UTSW	3	88,914,571 (GRCm39)	missense	probably benign
R7857:Ash1l	UTSW	3	88,891,616 (GRCm39)	nonsense	probably null
R7889:Ash1l	UTSW	3	88,873,345 (GRCm39)	missense	probably benign	0.00
R7898:Ash1l	UTSW	3	88,890,932 (GRCm39)	missense	possibly damaging	0.54
R7931:Ash1l	UTSW	3	88,950,848 (GRCm39)	missense	probably damaging	1.00
R7937:Ash1l	UTSW	3	88,977,624 (GRCm39)	nonsense	probably null
R7973:Ash1l	UTSW	3	88,960,164 (GRCm39)	missense	probably benign
R8119:Ash1l	UTSW	3	88,942,734 (GRCm39)	missense	probably damaging	1.00
R8157:Ash1l	UTSW	3	88,971,014 (GRCm39)	critical splice donor site	probably null
R8162:Ash1l	UTSW	3	88,977,553 (GRCm39)	missense	probably damaging	0.99
R8194:Ash1l	UTSW	3	88,960,062 (GRCm39)	missense	probably damaging	1.00
R8306:Ash1l	UTSW	3	88,873,259 (GRCm39)	missense	probably benign	0.00
R8497:Ash1l	UTSW	3	88,914,951 (GRCm39)	missense	probably benign	0.02
R8558:Ash1l	UTSW	3	88,891,713 (GRCm39)	missense	probably damaging	0.96
R8744:Ash1l	UTSW	3	88,965,890 (GRCm39)	missense	possibly damaging	0.89
R8923:Ash1l	UTSW	3	88,892,974 (GRCm39)	missense	possibly damaging	0.51
R8969:Ash1l	UTSW	3	88,873,598 (GRCm39)	missense	possibly damaging	0.52
R8970:Ash1l	UTSW	3	88,976,307 (GRCm39)	missense	probably benign	0.00
R9002:Ash1l	UTSW	3	88,888,715 (GRCm39)	missense	probably benign	0.17
R9023:Ash1l	UTSW	3	88,892,576 (GRCm39)	missense	probably damaging	1.00
R9032:Ash1l	UTSW	3	88,891,529 (GRCm39)	missense	probably benign	0.00
R9032:Ash1l	UTSW	3	88,889,294 (GRCm39)	missense	probably benign	0.19
R9049:Ash1l	UTSW	3	88,914,671 (GRCm39)	missense	probably benign
R9085:Ash1l	UTSW	3	88,891,529 (GRCm39)	missense	probably benign	0.00
R9085:Ash1l	UTSW	3	88,889,294 (GRCm39)	missense	probably benign	0.19
R9130:Ash1l	UTSW	3	88,965,848 (GRCm39)	nonsense	probably null
R9149:Ash1l	UTSW	3	88,914,530 (GRCm39)	missense	probably benign
R9294:Ash1l	UTSW	3	88,890,297 (GRCm39)	missense	possibly damaging	0.90
R9365:Ash1l	UTSW	3	88,889,207 (GRCm39)	missense	possibly damaging	0.63
R9450:Ash1l	UTSW	3	88,915,139 (GRCm39)	missense	possibly damaging	0.86
R9542:Ash1l	UTSW	3	88,950,566 (GRCm39)	missense	probably damaging	1.00
R9558:Ash1l	UTSW	3	88,889,521 (GRCm39)	missense	probably benign	0.02
R9572:Ash1l	UTSW	3	88,960,188 (GRCm39)	missense	probably damaging	1.00
R9688:Ash1l	UTSW	3	88,892,024 (GRCm39)	missense	probably damaging	1.00
R9736:Ash1l	UTSW	3	88,891,733 (GRCm39)	missense	probably damaging	1.00
R9765:Ash1l	UTSW	3	88,930,500 (GRCm39)	missense	probably damaging	1.00
R9789:Ash1l	UTSW	3	88,873,373 (GRCm39)	missense	probably benign
X0017:Ash1l	UTSW	3	88,891,892 (GRCm39)	missense	probably benign	0.45
X0019:Ash1l	UTSW	3	88,977,863 (GRCm39)	missense	probably damaging	1.00
X0021:Ash1l	UTSW	3	88,890,511 (GRCm39)	missense	probably benign	0.10
Z1088:Ash1l	UTSW	3	88,890,016 (GRCm39)	missense	probably benign	0.00
Z1176:Ash1l	UTSW	3	88,950,524 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCTGGCCAGCAAAAGAG -3'
(R):5'- ACACTTCTGGGATTTGTACCTAG -3'

Sequencing Primer
(F):5'- GCAGAGATAGAGGGTGCCAC -3'
(R):5'- ACTTCTGGGATTTGTACCTAGTATAG -3'

Posted On

2014-09-17