Mutagenetix > Incidental Mutation

Incidental Mutation 'R2070:Rint1'

227035

Institutional Source

Beutler Lab

Gene Symbol

Rint1

Ensembl Gene

ENSMUSG00000028999

Gene Name

RAD50 interactor 1

Synonyms

2810450M21Rik, 1500019C06Rik

MMRRC Submission

040075-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2070 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

23787711-23820369 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 23810929 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 456 (S456P)

Ref Sequence

ENSEMBL: ENSMUSP00000030852 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030852] [ENSMUST00000115113]

AlphaFold

Q8BZ36

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030852
AA Change: S456P

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000030852
Gene: ENSMUSG00000028999
AA Change: S456P

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	304	784	2.3e-135	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000115113
AA Change: S398P

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000110766
Gene: ENSMUSG00000028999
AA Change: S398P

Domain	Start	End	E-Value	Type
Pfam:RINT1_TIP1	246	727	1.2e-161	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122963

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124680

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132260

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144709

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein first identified for its ability to interact with the RAD50 double strand break repair protein, with the resulting interaction implicated in the regulation of cell cycle progression and telomere length. The encoded protein may also play a role in trafficking of cellular cargo from the endosome to the trans-Golgi network. Mutations in this gene may be associated with breast cancer in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a mutant allele exhibit early embryonic lethality. Mice heterozygous for a mutant allele exhibit premature death with a life span of 24 months and increased multiple tumor incidence. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	A	G	11: 58,876,769	K31E	probably damaging	Het
4930548H24Rik	T	C	5: 31,487,383	V160A	possibly damaging	Het
9130011E15Rik	G	T	19: 45,891,285	P543Q	probably damaging	Het
Abcc10	G	C	17: 46,303,565	N1477K	probably benign	Het
Ablim2	G	A	5: 35,798,513	C24Y	probably damaging	Het
Ankle1	T	C	8: 71,409,344	F497S	probably damaging	Het
Ash1l	C	G	3: 88,966,203	P98A	probably damaging	Het
Atad5	A	T	11: 80,098,052		probably null	Het
B3gnt4	A	T	5: 123,511,370	H266L	probably benign	Het
Bmi1	A	G	2: 18,684,040	I207V	probably benign	Het
Bnip3l	A	G	14: 66,989,222	M174T	probably damaging	Het
Bora	T	C	14: 99,062,278	S229P	probably damaging	Het
Ccdc27	T	A	4: 154,041,813	N73I	unknown	Het
Cdc42bpg	T	A	19: 6,320,488	C1204S	probably damaging	Het
Cdsn	A	T	17: 35,554,694	D40V	probably damaging	Het
Cilp	T	A	9: 65,279,095	V824D	probably damaging	Het
Cmtr1	A	G	17: 29,694,783		probably null	Het
Cntnap1	A	G	11: 101,182,979	Y652C	probably damaging	Het
Col12a1	T	C	9: 79,647,696	I2033M	probably benign	Het
Cwh43	T	C	5: 73,421,517	L289P	probably damaging	Het
Ddhd1	T	C	14: 45,610,624	D529G	probably damaging	Het
Defb28	T	A	2: 152,520,144	S75T	probably benign	Het
Dennd2a	A	T	6: 39,465,119	V939D	probably damaging	Het
Dlg5	T	C	14: 24,136,635	R1866G	probably damaging	Het
Dsc1	C	T	18: 20,088,296		probably null	Het
Ecscr	T	G	18: 35,715,437	N184T	probably damaging	Het
Eif4ebp1	G	T	8: 27,273,344	R55L	probably damaging	Het
Eml1	G	T	12: 108,512,999	V344L	probably damaging	Het
Exoc2	G	T	13: 30,815,370	N901K	probably benign	Het
Fam161b	T	A	12: 84,356,428	I143F	probably benign	Het
Fam180a	A	G	6: 35,325,911	S2P	probably benign	Het
Fam57b	T	C	7: 126,819,840	L4P	probably benign	Het
Fat3	T	A	9: 15,999,370	I1779F	probably benign	Het
Fat4	A	G	3: 39,010,655	K4920R	probably benign	Het
Fsip2	T	A	2: 82,976,355	V1006E	probably damaging	Het
Glcci1	A	G	6: 8,558,566	S30G	probably damaging	Het
Gm13078	T	G	4: 143,726,902	Y193*	probably null	Het
Gm5414	A	T	15: 101,628,060	S43R	possibly damaging	Het
Hao1	T	C	2: 134,530,615	T158A	probably damaging	Het
Hic1	T	C	11: 75,169,059	H154R	possibly damaging	Het
Hmgxb3	T	C	18: 61,171,359	Y53C	probably damaging	Het
Ipmk	A	T	10: 71,372,749	K122*	probably null	Het
Jakmip2	T	C	18: 43,563,330	E518G	probably benign	Het
Kmt2e	A	G	5: 23,501,995	T1519A	probably benign	Het
Lfng	T	C	5: 140,612,595	I224T	possibly damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Map4k5	C	T	12: 69,816,337	V629I	probably damaging	Het
Med12l	A	G	3: 59,244,905	D1037G	probably damaging	Het
Morc1	C	T	16: 48,592,611	T705I	probably benign	Het
Mptx2	A	T	1: 173,274,578	Y181*	probably null	Het
Mrpl24	T	C	3: 87,923,067		probably null	Het
Myo5a	A	G	9: 75,181,984	E1132G	probably benign	Het
Nedd4l	T	G	18: 65,212,820	F814L	probably damaging	Het
Nmral1	T	A	16: 4,716,347	I77F	probably damaging	Het
Oit3	T	G	10: 59,431,013	I224L	probably benign	Het
Oxsm	A	G	14: 16,241,983	L262P	probably benign	Het
Pacs2	C	T	12: 113,061,111	T407I	probably damaging	Het
Pard6g	T	C	18: 80,117,725	I351T	probably benign	Het
Pdcl2	A	T	5: 76,324,991		probably null	Het
Pdzph1	T	C	17: 58,974,097	R397G	probably benign	Het
Phip	T	A	9: 82,875,299	I1607L	probably benign	Het
Plekhd1	C	A	12: 80,692,907	S10*	probably null	Het
Prdm1	C	T	10: 44,441,412	D505N	possibly damaging	Het
Psmd13	T	C	7: 140,897,648	V320A	probably damaging	Het
Rbak	A	G	5: 143,176,584	L8P	probably damaging	Het
Rere	C	A	4: 150,614,590		probably benign	Het
Scn3a	T	C	2: 65,520,866	Q446R	possibly damaging	Het
Slitrk5	A	G	14: 111,680,189	Y415C	probably damaging	Het
Snrnp200	A	G	2: 127,212,403	E210G	possibly damaging	Het
Snrnp200	A	G	2: 127,237,883	T1891A	probably benign	Het
Sohlh2	A	G	3: 55,207,622	I343V	probably benign	Het
Spin1	T	C	13: 51,144,537		probably null	Het
St14	T	A	9: 31,091,373	I745F	probably damaging	Het
Sv2a	G	A	3: 96,193,875	A730T	possibly damaging	Het
Tars2	C	A	3: 95,747,638	G113C	probably damaging	Het
Trp53	A	G	11: 69,589,632	D278G	probably damaging	Het
Ubxn7	T	A	16: 32,372,469	C160S	possibly damaging	Het
Uty	T	C	Y: 1,169,193	E414G	probably benign	Het
Wrap73	T	A	4: 154,148,743	S125T	possibly damaging	Het
Wwc2	T	C	8: 47,868,321	D586G	unknown	Het
Zfp106	T	C	2: 120,523,529	H1490R	probably benign	Het
Zswim5	T	C	4: 116,979,912	V731A	probably benign	Het
Zyg11b	G	C	4: 108,250,819	N463K	possibly damaging	Het

Other mutations in Rint1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rint1	APN	5	23794431	missense	probably benign	0.00
IGL00596:Rint1	APN	5	23811865	missense	probably damaging	0.99
IGL01685:Rint1	APN	5	23787834	unclassified	probably benign
IGL02428:Rint1	APN	5	23794452	nonsense	probably null
IGL03007:Rint1	APN	5	23815701	missense	probably benign	0.00
IGL03280:Rint1	APN	5	23817078	missense	probably damaging	1.00
breakage	UTSW	5	23800722	missense	probably damaging	0.99
IGL02799:Rint1	UTSW	5	23819480	missense	possibly damaging	0.93
R0062:Rint1	UTSW	5	23787828	unclassified	probably benign
R0243:Rint1	UTSW	5	23816932	splice site	probably benign
R1102:Rint1	UTSW	5	23805567	splice site	probably benign
R1552:Rint1	UTSW	5	23800658	missense	probably benign	0.00
R1729:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R1784:Rint1	UTSW	5	23809843	missense	probably benign	0.00
R2920:Rint1	UTSW	5	23805402	missense	probably benign	0.00
R3114:Rint1	UTSW	5	23819420	missense	probably benign	0.27
R4398:Rint1	UTSW	5	23794447	missense	possibly damaging	0.55
R4756:Rint1	UTSW	5	23809793	missense	probably damaging	1.00
R5246:Rint1	UTSW	5	23800811	missense	probably damaging	0.99
R5452:Rint1	UTSW	5	23794365	missense	probably benign	0.01
R5566:Rint1	UTSW	5	23810953	missense	probably damaging	1.00
R5709:Rint1	UTSW	5	23815833	missense	probably damaging	0.98
R6524:Rint1	UTSW	5	23815739	missense	probably benign	0.00
R7346:Rint1	UTSW	5	23815653	missense	possibly damaging	0.82
R7549:Rint1	UTSW	5	23815704	missense	probably benign
R7634:Rint1	UTSW	5	23805479	missense	probably benign	0.00
R7647:Rint1	UTSW	5	23800802	missense	probably damaging	1.00
R7885:Rint1	UTSW	5	23805644	missense	probably benign
R7895:Rint1	UTSW	5	23800722	missense	probably damaging	0.99
R8347:Rint1	UTSW	5	23811772	missense	probably damaging	1.00
R8791:Rint1	UTSW	5	23800596	missense	probably damaging	0.99
R8900:Rint1	UTSW	5	23811884	missense	possibly damaging	0.77
R8916:Rint1	UTSW	5	23787828	unclassified	probably benign
R8973:Rint1	UTSW	5	23811730	missense	probably benign	0.00
R9245:Rint1	UTSW	5	23805413	missense	probably benign
R9339:Rint1	UTSW	5	23788357	makesense	probably null
R9630:Rint1	UTSW	5	23815812	missense	possibly damaging	0.82
R9718:Rint1	UTSW	5	23800723	missense	possibly damaging	0.53
Z1088:Rint1	UTSW	5	23805314	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTATTGAGGGAGAATCAGGTATC -3'
(R):5'- TGCCACAGATTTCTACTAGTGTAG -3'

Sequencing Primer
(F):5'- GTGATTAGTTAGTGGGAGATTAA -3'
(R):5'- GCTAGGATTACAAGTGTGTACCCC -3'

Posted On

2014-09-17