Incidental Mutation 'R2070:Phip'
ID227062
Institutional Source Beutler Lab
Gene Symbol Phip
Ensembl Gene ENSMUSG00000032253
Gene Namepleckstrin homology domain interacting protein
SynonymsWdr11, 2810004D21Rik, 4632404O06Rik, Ndrp
MMRRC Submission 040075-MU
Accession Numbers

Genbank: NM_001081216; MGI: 1932404

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2070 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location82866159-82975516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82875299 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1607 (I1607L)
Ref Sequence ENSEMBL: ENSMUSP00000034787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034787]
Predicted Effect probably benign
Transcript: ENSMUST00000034787
AA Change: I1607L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034787
Gene: ENSMUSG00000032253
AA Change: I1607L

DomainStartEndE-ValueType
WD40 172 211 1.5e-8 SMART
WD40 214 253 4.1e-9 SMART
WD40 256 299 3.5e-7 SMART
WD40 310 349 1.4e-1 SMART
WD40 354 393 6.6e-10 SMART
WD40 408 452 1.4e-2 SMART
WD40 455 495 3.4e-10 SMART
WD40 498 542 6.6e-2 SMART
low complexity region 802 813 N/A INTRINSIC
low complexity region 841 854 N/A INTRINSIC
low complexity region 865 877 N/A INTRINSIC
coiled coil region 881 907 N/A INTRINSIC
low complexity region 928 941 N/A INTRINSIC
BROMO 1158 1261 3.5e-11 SMART
BROMO 1318 1423 4.1e-30 SMART
low complexity region 1438 1463 N/A INTRINSIC
low complexity region 1500 1513 N/A INTRINSIC
low complexity region 1708 1721 N/A INTRINSIC
low complexity region 1752 1758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190774
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to the insulin receptor substrate 1 protein and regulates glucose transporter translocation in skeletal muscle cells. The encoded protein may also regulate growth and survival of pancreatic beta cells. Elevated copy number of this gene may be associated with melanoma severity and the encoded protein may promote melanoma metastasis in human patients. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal and premature lethality associated with reduced body size, small myocardial cells and hepatocytes, hypoglycemia, increased insulin sensitivity, and reduced cell growth. [provided by MGI curators]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
4930548H24Rik T C 5: 31,487,383 V160A possibly damaging Het
9130011E15Rik G T 19: 45,891,285 P543Q probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Ablim2 G A 5: 35,798,513 C24Y probably damaging Het
Ankle1 T C 8: 71,409,344 F497S probably damaging Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bmi1 A G 2: 18,684,040 I207V probably benign Het
Bnip3l A G 14: 66,989,222 M174T probably damaging Het
Bora T C 14: 99,062,278 S229P probably damaging Het
Ccdc27 T A 4: 154,041,813 N73I unknown Het
Cdc42bpg T A 19: 6,320,488 C1204S probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cilp T A 9: 65,279,095 V824D probably damaging Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cntnap1 A G 11: 101,182,979 Y652C probably damaging Het
Col12a1 T C 9: 79,647,696 I2033M probably benign Het
Cwh43 T C 5: 73,421,517 L289P probably damaging Het
Ddhd1 T C 14: 45,610,624 D529G probably damaging Het
Defb28 T A 2: 152,520,144 S75T probably benign Het
Dennd2a A T 6: 39,465,119 V939D probably damaging Het
Dlg5 T C 14: 24,136,635 R1866G probably damaging Het
Dsc1 C T 18: 20,088,296 probably null Het
Ecscr T G 18: 35,715,437 N184T probably damaging Het
Eif4ebp1 G T 8: 27,273,344 R55L probably damaging Het
Eml1 G T 12: 108,512,999 V344L probably damaging Het
Exoc2 G T 13: 30,815,370 N901K probably benign Het
Fam161b T A 12: 84,356,428 I143F probably benign Het
Fam180a A G 6: 35,325,911 S2P probably benign Het
Fam57b T C 7: 126,819,840 L4P probably benign Het
Fat3 T A 9: 15,999,370 I1779F probably benign Het
Fat4 A G 3: 39,010,655 K4920R probably benign Het
Fsip2 T A 2: 82,976,355 V1006E probably damaging Het
Glcci1 A G 6: 8,558,566 S30G probably damaging Het
Gm13078 T G 4: 143,726,902 Y193* probably null Het
Gm5414 A T 15: 101,628,060 S43R possibly damaging Het
Hao1 T C 2: 134,530,615 T158A probably damaging Het
Hic1 T C 11: 75,169,059 H154R possibly damaging Het
Hmgxb3 T C 18: 61,171,359 Y53C probably damaging Het
Ipmk A T 10: 71,372,749 K122* probably null Het
Jakmip2 T C 18: 43,563,330 E518G probably benign Het
Kmt2e A G 5: 23,501,995 T1519A probably benign Het
Lfng T C 5: 140,612,595 I224T possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map4k5 C T 12: 69,816,337 V629I probably damaging Het
Med12l A G 3: 59,244,905 D1037G probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mptx2 A T 1: 173,274,578 Y181* probably null Het
Mrpl24 T C 3: 87,923,067 probably null Het
Myo5a A G 9: 75,181,984 E1132G probably benign Het
Nedd4l T G 18: 65,212,820 F814L probably damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Oit3 T G 10: 59,431,013 I224L probably benign Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pacs2 C T 12: 113,061,111 T407I probably damaging Het
Pard6g T C 18: 80,117,725 I351T probably benign Het
Pdcl2 A T 5: 76,324,991 probably null Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Plekhd1 C A 12: 80,692,907 S10* probably null Het
Prdm1 C T 10: 44,441,412 D505N possibly damaging Het
Psmd13 T C 7: 140,897,648 V320A probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rere C A 4: 150,614,590 probably benign Het
Rint1 T C 5: 23,810,929 S456P possibly damaging Het
Scn3a T C 2: 65,520,866 Q446R possibly damaging Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Snrnp200 A G 2: 127,212,403 E210G possibly damaging Het
Snrnp200 A G 2: 127,237,883 T1891A probably benign Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Spin1 T C 13: 51,144,537 probably null Het
St14 T A 9: 31,091,373 I745F probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Uty T C Y: 1,169,193 E414G probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Wwc2 T C 8: 47,868,321 D586G unknown Het
Zfp106 T C 2: 120,523,529 H1490R probably benign Het
Zswim5 T C 4: 116,979,912 V731A probably benign Het
Zyg11b G C 4: 108,250,819 N463K possibly damaging Het
Other mutations in Phip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Phip APN 9 82871303 missense probably damaging 0.99
IGL01510:Phip APN 9 82913871 missense probably benign 0.01
IGL01916:Phip APN 9 82890469 missense possibly damaging 0.61
IGL02068:Phip APN 9 82945808 missense probably damaging 1.00
IGL02089:Phip APN 9 82871319 missense probably damaging 1.00
IGL02121:Phip APN 9 82893370 missense probably damaging 1.00
IGL02132:Phip APN 9 82881341 missense possibly damaging 0.91
IGL02146:Phip APN 9 82881718 missense probably benign 0.05
IGL02282:Phip APN 9 82913690 missense probably benign 0.09
IGL02341:Phip APN 9 82932883 missense probably damaging 1.00
IGL02342:Phip APN 9 82886692 missense probably damaging 1.00
IGL02470:Phip APN 9 82890454 missense possibly damaging 0.69
IGL02585:Phip APN 9 82903188 missense probably benign 0.03
IGL03271:Phip APN 9 82884824 splice site probably benign
3-1:Phip UTSW 9 82886671 missense probably damaging 1.00
R0102:Phip UTSW 9 82905792 splice site probably null
R0102:Phip UTSW 9 82905792 splice site probably null
R0137:Phip UTSW 9 82927191 splice site probably null
R0268:Phip UTSW 9 82871288 missense probably damaging 1.00
R0366:Phip UTSW 9 82926407 missense probably damaging 1.00
R0421:Phip UTSW 9 82926457 missense probably damaging 1.00
R0481:Phip UTSW 9 82876716 splice site probably benign
R0883:Phip UTSW 9 82876221 missense probably benign 0.01
R0885:Phip UTSW 9 82875395 missense probably benign 0.06
R1300:Phip UTSW 9 82876747 missense probably benign 0.00
R1434:Phip UTSW 9 82959605 missense probably damaging 0.99
R1448:Phip UTSW 9 82915423 missense possibly damaging 0.92
R1588:Phip UTSW 9 82900828 missense probably damaging 1.00
R1619:Phip UTSW 9 82871449 missense probably benign 0.20
R1658:Phip UTSW 9 82871498 missense probably benign
R1688:Phip UTSW 9 82871657 missense probably benign
R1773:Phip UTSW 9 82876189 missense probably benign
R1865:Phip UTSW 9 82945792 missense probably damaging 1.00
R1934:Phip UTSW 9 82903182 missense probably benign 0.11
R2096:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2097:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2099:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2192:Phip UTSW 9 82871815 missense probably damaging 0.99
R2402:Phip UTSW 9 82875305 missense probably benign
R2447:Phip UTSW 9 82915399 missense probably damaging 0.99
R2504:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2507:Phip UTSW 9 82915339 missense possibly damaging 0.95
R2508:Phip UTSW 9 82915339 missense possibly damaging 0.95
R3706:Phip UTSW 9 82900743 missense probably benign 0.02
R3829:Phip UTSW 9 82871645 missense probably benign
R3846:Phip UTSW 9 82876126 nonsense probably null
R4301:Phip UTSW 9 82959713 nonsense probably null
R4366:Phip UTSW 9 82900869 intron probably benign
R4748:Phip UTSW 9 82908869 missense probably benign 0.01
R4895:Phip UTSW 9 82959595 missense probably benign 0.20
R5001:Phip UTSW 9 82896019 splice site probably null
R5094:Phip UTSW 9 82871844 missense probably benign
R5181:Phip UTSW 9 82871190 utr 3 prime probably benign
R5194:Phip UTSW 9 82908862 missense probably benign 0.03
R5291:Phip UTSW 9 82945883 missense probably damaging 1.00
R5335:Phip UTSW 9 82900756 missense possibly damaging 0.93
R5458:Phip UTSW 9 82926500 missense probably benign 0.40
R5704:Phip UTSW 9 82871355 missense probably damaging 0.97
R5866:Phip UTSW 9 82890150 missense probably benign
R5870:Phip UTSW 9 82908677 splice site probably benign
R5890:Phip UTSW 9 82906952 missense probably benign 0.00
R6232:Phip UTSW 9 82903181 missense probably benign
R6379:Phip UTSW 9 82913857 missense probably damaging 0.98
R6653:Phip UTSW 9 82900741 nonsense probably null
R7129:Phip UTSW 9 82877300 missense probably damaging 0.98
R7290:Phip UTSW 9 82871293 missense possibly damaging 0.94
R7598:Phip UTSW 9 82905658 missense possibly damaging 0.94
R7632:Phip UTSW 9 82903190 missense probably benign
R7752:Phip UTSW 9 82890150 missense probably benign
R7827:Phip UTSW 9 82908833 missense probably benign
R7901:Phip UTSW 9 82890150 missense probably benign
R7984:Phip UTSW 9 82890150 missense probably benign
R8006:Phip UTSW 9 82890126 missense possibly damaging 0.93
R8066:Phip UTSW 9 82875298 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTCTGGCCAGCGCATTCAAG -3'
(R):5'- GACATTCCAAAGCCTTGAGC -3'

Sequencing Primer
(F):5'- GCCAGCGCATTCAAGCATTAC -3'
(R):5'- GCCTTGAGCACACTTTCCAG -3'
Posted On2014-09-17