Incidental Mutation 'R2070:Ipmk'
ID227065
Institutional Source Beutler Lab
Gene Symbol Ipmk
Ensembl Gene ENSMUSG00000060733
Gene Nameinositol polyphosphate multikinase
Synonyms
MMRRC Submission 040075-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2070 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location71347763-71433327 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 71372749 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 122 (K122*)
Ref Sequence ENSEMBL: ENSMUSP00000120073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079252] [ENSMUST00000118381] [ENSMUST00000121446] [ENSMUST00000147277]
Predicted Effect probably null
Transcript: ENSMUST00000079252
AA Change: K122*
SMART Domains Protein: ENSMUSP00000078240
Gene: ENSMUSG00000060733
AA Change: K122*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 110 391 1.4e-69 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118381
AA Change: K122*
SMART Domains Protein: ENSMUSP00000113083
Gene: ENSMUSG00000060733
AA Change: K122*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 110 194 8.2e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121446
AA Change: K123*
SMART Domains Protein: ENSMUSP00000112568
Gene: ENSMUSG00000060733
AA Change: K123*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 111 392 2.6e-70 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000147277
AA Change: K122*
SMART Domains Protein: ENSMUSP00000120073
Gene: ENSMUSG00000060733
AA Change: K122*

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:IPK 110 194 8.2e-33 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inositol phosphokinase family. The encoded protein has 3-kinase, 5-kinase and 6-kinase activities on phosphorylated inositol substrates. The encoded protein plays an important role in the biosynthesis of inositol 1,3,4,5,6-pentakisphosphate, and has a preferred 5-kinase activity. This gene may play a role in nuclear mRNA export. Pseudogenes of this gene are located on the long arm of chromosome 13 and the short arm of chromosome 19. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality, reduced embryo size, delayed embryonic development, failure of chorioallantoic fusion and embryo turning, and a kinked and open neural tube. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
4930548H24Rik T C 5: 31,487,383 V160A possibly damaging Het
9130011E15Rik G T 19: 45,891,285 P543Q probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Ablim2 G A 5: 35,798,513 C24Y probably damaging Het
Ankle1 T C 8: 71,409,344 F497S probably damaging Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bmi1 A G 2: 18,684,040 I207V probably benign Het
Bnip3l A G 14: 66,989,222 M174T probably damaging Het
Bora T C 14: 99,062,278 S229P probably damaging Het
Ccdc27 T A 4: 154,041,813 N73I unknown Het
Cdc42bpg T A 19: 6,320,488 C1204S probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cilp T A 9: 65,279,095 V824D probably damaging Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cntnap1 A G 11: 101,182,979 Y652C probably damaging Het
Col12a1 T C 9: 79,647,696 I2033M probably benign Het
Cwh43 T C 5: 73,421,517 L289P probably damaging Het
Ddhd1 T C 14: 45,610,624 D529G probably damaging Het
Defb28 T A 2: 152,520,144 S75T probably benign Het
Dennd2a A T 6: 39,465,119 V939D probably damaging Het
Dlg5 T C 14: 24,136,635 R1866G probably damaging Het
Dsc1 C T 18: 20,088,296 probably null Het
Ecscr T G 18: 35,715,437 N184T probably damaging Het
Eif4ebp1 G T 8: 27,273,344 R55L probably damaging Het
Eml1 G T 12: 108,512,999 V344L probably damaging Het
Exoc2 G T 13: 30,815,370 N901K probably benign Het
Fam161b T A 12: 84,356,428 I143F probably benign Het
Fam180a A G 6: 35,325,911 S2P probably benign Het
Fam57b T C 7: 126,819,840 L4P probably benign Het
Fat3 T A 9: 15,999,370 I1779F probably benign Het
Fat4 A G 3: 39,010,655 K4920R probably benign Het
Fsip2 T A 2: 82,976,355 V1006E probably damaging Het
Glcci1 A G 6: 8,558,566 S30G probably damaging Het
Gm13078 T G 4: 143,726,902 Y193* probably null Het
Gm5414 A T 15: 101,628,060 S43R possibly damaging Het
Hao1 T C 2: 134,530,615 T158A probably damaging Het
Hic1 T C 11: 75,169,059 H154R possibly damaging Het
Hmgxb3 T C 18: 61,171,359 Y53C probably damaging Het
Jakmip2 T C 18: 43,563,330 E518G probably benign Het
Kmt2e A G 5: 23,501,995 T1519A probably benign Het
Lfng T C 5: 140,612,595 I224T possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map4k5 C T 12: 69,816,337 V629I probably damaging Het
Med12l A G 3: 59,244,905 D1037G probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mptx2 A T 1: 173,274,578 Y181* probably null Het
Mrpl24 T C 3: 87,923,067 probably null Het
Myo5a A G 9: 75,181,984 E1132G probably benign Het
Nedd4l T G 18: 65,212,820 F814L probably damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Oit3 T G 10: 59,431,013 I224L probably benign Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pacs2 C T 12: 113,061,111 T407I probably damaging Het
Pard6g T C 18: 80,117,725 I351T probably benign Het
Pdcl2 A T 5: 76,324,991 probably null Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Phip T A 9: 82,875,299 I1607L probably benign Het
Plekhd1 C A 12: 80,692,907 S10* probably null Het
Prdm1 C T 10: 44,441,412 D505N possibly damaging Het
Psmd13 T C 7: 140,897,648 V320A probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rere C A 4: 150,614,590 probably benign Het
Rint1 T C 5: 23,810,929 S456P possibly damaging Het
Scn3a T C 2: 65,520,866 Q446R possibly damaging Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Snrnp200 A G 2: 127,212,403 E210G possibly damaging Het
Snrnp200 A G 2: 127,237,883 T1891A probably benign Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Spin1 T C 13: 51,144,537 probably null Het
St14 T A 9: 31,091,373 I745F probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Uty T C Y: 1,169,193 E414G probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Wwc2 T C 8: 47,868,321 D586G unknown Het
Zfp106 T C 2: 120,523,529 H1490R probably benign Het
Zswim5 T C 4: 116,979,912 V731A probably benign Het
Zyg11b G C 4: 108,250,819 N463K possibly damaging Het
Other mutations in Ipmk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Ipmk APN 10 71376766 missense probably damaging 0.99
IGL01524:Ipmk APN 10 71372801 missense probably damaging 1.00
IGL01872:Ipmk APN 10 71372876 missense probably damaging 1.00
I1329:Ipmk UTSW 10 71381447 missense possibly damaging 0.46
R0282:Ipmk UTSW 10 71372831 missense probably benign 0.06
R1477:Ipmk UTSW 10 71381777 missense probably damaging 1.00
R1759:Ipmk UTSW 10 71381303 missense probably damaging 1.00
R2042:Ipmk UTSW 10 71363503 missense probably damaging 1.00
R2160:Ipmk UTSW 10 71381426 missense probably benign 0.00
R2520:Ipmk UTSW 10 71381217 missense probably damaging 1.00
R4570:Ipmk UTSW 10 71372739 missense probably benign 0.04
R5522:Ipmk UTSW 10 71363474 missense probably benign 0.30
R6941:Ipmk UTSW 10 71348090 missense probably null 1.00
R7198:Ipmk UTSW 10 71348052 missense probably damaging 1.00
R7203:Ipmk UTSW 10 71363468 missense possibly damaging 0.67
R7414:Ipmk UTSW 10 71381294 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGATGTCTGGTCACACGGAG -3'
(R):5'- CTCACACTACATGGAGTGTTGCG -3'

Sequencing Primer
(F):5'- GTCACACGGAGCAGACATTTGTC -3'
(R):5'- CACTACATGGAGTGTTGCGTAAGG -3'
Posted On2014-09-17