Incidental Mutation 'R2070:Trp53'
ID227067
Institutional Source Beutler Lab
Gene Symbol Trp53
Ensembl Gene ENSMUSG00000059552
Gene Nametransformation related protein 53
Synonymsp44, p53
MMRRC Submission 040075-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2070 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69580359-69591873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69589632 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 278 (D278G)
Ref Sequence ENSEMBL: ENSMUSP00000104298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005371] [ENSMUST00000108657] [ENSMUST00000108658] [ENSMUST00000171247]
Predicted Effect probably damaging
Transcript: ENSMUST00000005371
AA Change: D275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005371
Gene: ENSMUSG00000059552
AA Change: D275G

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 1.3e-10 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 8.2e-108 PFAM
Pfam:P53_tetramer 312 353 4.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108657
AA Change: D275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104297
Gene: ENSMUSG00000059552
AA Change: D275G

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 6.1e-11 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 4.7e-108 PFAM
Pfam:P53_tetramer 312 353 1.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108658
AA Change: D278G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104298
Gene: ENSMUSG00000059552
AA Change: D278G

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.4e-12 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 9.8e-113 PFAM
Pfam:P53_tetramer 316 355 5.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147512
Predicted Effect probably damaging
Transcript: ENSMUST00000171247
AA Change: D278G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127130
Gene: ENSMUSG00000059552
AA Change: D278G

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.2e-10 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 7.9e-108 PFAM
Pfam:P53_tetramer 315 356 4.3e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes tumor protein p53, which responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 is a DNA-binding protein containing transcription activation, DNA-binding, and oligomerization domains. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mice deficient for this gene are developmentally normal but are susceptible to spontaneous tumors. Evidence to date shows that this gene contains one promoter, in contrast to alternative promoters of the human gene, and transcribes a few of splice variants which encode different isoforms, although the biological validity or the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this locus affect cell-cycle regulation and apoptosis. Null homozygotes show high, early-onset tumor incidence; some have persistent hyaloid vasculature and cataracts. Truncated or temperature-sensitive alleles cause early aging phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
4930548H24Rik T C 5: 31,487,383 V160A possibly damaging Het
9130011E15Rik G T 19: 45,891,285 P543Q probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Ablim2 G A 5: 35,798,513 C24Y probably damaging Het
Ankle1 T C 8: 71,409,344 F497S probably damaging Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bmi1 A G 2: 18,684,040 I207V probably benign Het
Bnip3l A G 14: 66,989,222 M174T probably damaging Het
Bora T C 14: 99,062,278 S229P probably damaging Het
Ccdc27 T A 4: 154,041,813 N73I unknown Het
Cdc42bpg T A 19: 6,320,488 C1204S probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cilp T A 9: 65,279,095 V824D probably damaging Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cntnap1 A G 11: 101,182,979 Y652C probably damaging Het
Col12a1 T C 9: 79,647,696 I2033M probably benign Het
Cwh43 T C 5: 73,421,517 L289P probably damaging Het
Ddhd1 T C 14: 45,610,624 D529G probably damaging Het
Defb28 T A 2: 152,520,144 S75T probably benign Het
Dennd2a A T 6: 39,465,119 V939D probably damaging Het
Dlg5 T C 14: 24,136,635 R1866G probably damaging Het
Dsc1 C T 18: 20,088,296 probably null Het
Ecscr T G 18: 35,715,437 N184T probably damaging Het
Eif4ebp1 G T 8: 27,273,344 R55L probably damaging Het
Eml1 G T 12: 108,512,999 V344L probably damaging Het
Exoc2 G T 13: 30,815,370 N901K probably benign Het
Fam161b T A 12: 84,356,428 I143F probably benign Het
Fam180a A G 6: 35,325,911 S2P probably benign Het
Fam57b T C 7: 126,819,840 L4P probably benign Het
Fat3 T A 9: 15,999,370 I1779F probably benign Het
Fat4 A G 3: 39,010,655 K4920R probably benign Het
Fsip2 T A 2: 82,976,355 V1006E probably damaging Het
Glcci1 A G 6: 8,558,566 S30G probably damaging Het
Gm13078 T G 4: 143,726,902 Y193* probably null Het
Gm5414 A T 15: 101,628,060 S43R possibly damaging Het
Hao1 T C 2: 134,530,615 T158A probably damaging Het
Hic1 T C 11: 75,169,059 H154R possibly damaging Het
Hmgxb3 T C 18: 61,171,359 Y53C probably damaging Het
Ipmk A T 10: 71,372,749 K122* probably null Het
Jakmip2 T C 18: 43,563,330 E518G probably benign Het
Kmt2e A G 5: 23,501,995 T1519A probably benign Het
Lfng T C 5: 140,612,595 I224T possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map4k5 C T 12: 69,816,337 V629I probably damaging Het
Med12l A G 3: 59,244,905 D1037G probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mptx2 A T 1: 173,274,578 Y181* probably null Het
Mrpl24 T C 3: 87,923,067 probably null Het
Myo5a A G 9: 75,181,984 E1132G probably benign Het
Nedd4l T G 18: 65,212,820 F814L probably damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Oit3 T G 10: 59,431,013 I224L probably benign Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pacs2 C T 12: 113,061,111 T407I probably damaging Het
Pard6g T C 18: 80,117,725 I351T probably benign Het
Pdcl2 A T 5: 76,324,991 probably null Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Phip T A 9: 82,875,299 I1607L probably benign Het
Plekhd1 C A 12: 80,692,907 S10* probably null Het
Prdm1 C T 10: 44,441,412 D505N possibly damaging Het
Psmd13 T C 7: 140,897,648 V320A probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rere C A 4: 150,614,590 probably benign Het
Rint1 T C 5: 23,810,929 S456P possibly damaging Het
Scn3a T C 2: 65,520,866 Q446R possibly damaging Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Snrnp200 A G 2: 127,212,403 E210G possibly damaging Het
Snrnp200 A G 2: 127,237,883 T1891A probably benign Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Spin1 T C 13: 51,144,537 probably null Het
St14 T A 9: 31,091,373 I745F probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Uty T C Y: 1,169,193 E414G probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Wwc2 T C 8: 47,868,321 D586G unknown Het
Zfp106 T C 2: 120,523,529 H1490R probably benign Het
Zswim5 T C 4: 116,979,912 V731A probably benign Het
Zyg11b G C 4: 108,250,819 N463K possibly damaging Het
Other mutations in Trp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Trp53 APN 11 69588523 missense probably damaging 1.00
IGL02105:Trp53 APN 11 69588503 missense probably damaging 1.00
R0112:Trp53 UTSW 11 69588679 missense probably damaging 1.00
R0196:Trp53 UTSW 11 69588680 missense probably damaging 1.00
R0512:Trp53 UTSW 11 69588683 missense probably damaging 1.00
R1976:Trp53 UTSW 11 69588497 missense probably damaging 1.00
R2071:Trp53 UTSW 11 69589632 missense probably damaging 1.00
R2988:Trp53 UTSW 11 69588506 missense probably damaging 1.00
R4698:Trp53 UTSW 11 69588422 nonsense probably null
R4776:Trp53 UTSW 11 69586921 missense probably benign 0.05
R4838:Trp53 UTSW 11 69587630 missense probably damaging 1.00
R5269:Trp53 UTSW 11 69589205 missense probably damaging 1.00
R5360:Trp53 UTSW 11 69588740 critical splice donor site probably null
R5399:Trp53 UTSW 11 69588546 missense probably benign 0.19
R5420:Trp53 UTSW 11 69588320 intron probably benign
R5982:Trp53 UTSW 11 69587418 missense probably benign 0.06
R6051:Trp53 UTSW 11 69589608 missense possibly damaging 0.93
R6305:Trp53 UTSW 11 69588707 missense probably damaging 1.00
R6457:Trp53 UTSW 11 69589614 missense probably damaging 1.00
R6947:Trp53 UTSW 11 69588481 missense possibly damaging 0.93
R7278:Trp53 UTSW 11 69591255 missense probably benign 0.00
R7339:Trp53 UTSW 11 69589189 missense probably damaging 1.00
R7418:Trp53 UTSW 11 69588388 missense probably damaging 1.00
R7899:Trp53 UTSW 11 69590693 missense probably damaging 1.00
R7982:Trp53 UTSW 11 69590693 missense probably damaging 1.00
Z1176:Trp53 UTSW 11 69589202 missense probably damaging 1.00
Z1176:Trp53 UTSW 11 69589250 missense probably null 0.94
Z1177:Trp53 UTSW 11 69588362 critical splice acceptor site probably null
Z1177:Trp53 UTSW 11 69589211 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AACTGGACCTTTGGCTGCAG -3'
(R):5'- GGGTGAAATACTCTCCATCAAGTG -3'

Sequencing Primer
(F):5'- CCTTTGGCTGCAGATATGACAAG -3'
(R):5'- AGAGGCGCTTGTGCAGG -3'
Posted On2014-09-17