Incidental Mutation 'R2070:Hic1'
ID 227068
Institutional Source Beutler Lab
Gene Symbol Hic1
Ensembl Gene ENSMUSG00000043099
Gene Name hypermethylated in cancer 1
Synonyms HIC-1
MMRRC Submission 040075-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R2070 (G1)
Quality Score 143
Status Not validated
Chromosome 11
Chromosomal Location 75164565-75169519 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75169059 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 154 (H154R)
Ref Sequence ENSEMBL: ENSMUSP00000053483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000055619]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045281
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000055619
AA Change: H154R

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053483
Gene: ENSMUSG00000043099
AA Change: H154R

DomainStartEndE-ValueType
low complexity region 71 81 N/A INTRINSIC
low complexity region 192 200 N/A INTRINSIC
BTB 207 313 6.94e-24 SMART
low complexity region 318 340 N/A INTRINSIC
low complexity region 350 370 N/A INTRINSIC
Blast:BTB 375 398 1e-7 BLAST
low complexity region 415 437 N/A INTRINSIC
low complexity region 442 453 N/A INTRINSIC
low complexity region 464 486 N/A INTRINSIC
low complexity region 519 542 N/A INTRINSIC
ZnF_C2H2 597 619 1.08e-1 SMART
ZnF_C2H2 667 689 1.18e-2 SMART
ZnF_C2H2 695 717 9.36e-6 SMART
ZnF_C2H2 723 745 4.54e-4 SMART
ZnF_C2H2 751 773 5.21e-4 SMART
low complexity region 774 804 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083656
Predicted Effect probably benign
Transcript: ENSMUST00000130145
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131720
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134252
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions as a growth regulatory and tumor repressor gene. Hypermethylation or deletion of the region of this gene have been associated with tumors and the contiguous-gene syndrome, Miller-Dieker syndrome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit varying abnormalities, such as acrania, exencephaly, cleft palate, limb defects, and omphalocele, and die perinatally. Heterozygotes develop tumors, including lymphomas, sarcomas, and epithelial cancers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
4930548H24Rik T C 5: 31,487,383 V160A possibly damaging Het
9130011E15Rik G T 19: 45,891,285 P543Q probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Ablim2 G A 5: 35,798,513 C24Y probably damaging Het
Ankle1 T C 8: 71,409,344 F497S probably damaging Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bmi1 A G 2: 18,684,040 I207V probably benign Het
Bnip3l A G 14: 66,989,222 M174T probably damaging Het
Bora T C 14: 99,062,278 S229P probably damaging Het
Ccdc27 T A 4: 154,041,813 N73I unknown Het
Cdc42bpg T A 19: 6,320,488 C1204S probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cilp T A 9: 65,279,095 V824D probably damaging Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cntnap1 A G 11: 101,182,979 Y652C probably damaging Het
Col12a1 T C 9: 79,647,696 I2033M probably benign Het
Cwh43 T C 5: 73,421,517 L289P probably damaging Het
Ddhd1 T C 14: 45,610,624 D529G probably damaging Het
Defb28 T A 2: 152,520,144 S75T probably benign Het
Dennd2a A T 6: 39,465,119 V939D probably damaging Het
Dlg5 T C 14: 24,136,635 R1866G probably damaging Het
Dsc1 C T 18: 20,088,296 probably null Het
Ecscr T G 18: 35,715,437 N184T probably damaging Het
Eif4ebp1 G T 8: 27,273,344 R55L probably damaging Het
Eml1 G T 12: 108,512,999 V344L probably damaging Het
Exoc2 G T 13: 30,815,370 N901K probably benign Het
Fam161b T A 12: 84,356,428 I143F probably benign Het
Fam180a A G 6: 35,325,911 S2P probably benign Het
Fam57b T C 7: 126,819,840 L4P probably benign Het
Fat3 T A 9: 15,999,370 I1779F probably benign Het
Fat4 A G 3: 39,010,655 K4920R probably benign Het
Fsip2 T A 2: 82,976,355 V1006E probably damaging Het
Glcci1 A G 6: 8,558,566 S30G probably damaging Het
Gm13078 T G 4: 143,726,902 Y193* probably null Het
Gm5414 A T 15: 101,628,060 S43R possibly damaging Het
Hao1 T C 2: 134,530,615 T158A probably damaging Het
Hmgxb3 T C 18: 61,171,359 Y53C probably damaging Het
Ipmk A T 10: 71,372,749 K122* probably null Het
Jakmip2 T C 18: 43,563,330 E518G probably benign Het
Kmt2e A G 5: 23,501,995 T1519A probably benign Het
Lfng T C 5: 140,612,595 I224T possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map4k5 C T 12: 69,816,337 V629I probably damaging Het
Med12l A G 3: 59,244,905 D1037G probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mptx2 A T 1: 173,274,578 Y181* probably null Het
Mrpl24 T C 3: 87,923,067 probably null Het
Myo5a A G 9: 75,181,984 E1132G probably benign Het
Nedd4l T G 18: 65,212,820 F814L probably damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Oit3 T G 10: 59,431,013 I224L probably benign Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pacs2 C T 12: 113,061,111 T407I probably damaging Het
Pard6g T C 18: 80,117,725 I351T probably benign Het
Pdcl2 A T 5: 76,324,991 probably null Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Phip T A 9: 82,875,299 I1607L probably benign Het
Plekhd1 C A 12: 80,692,907 S10* probably null Het
Prdm1 C T 10: 44,441,412 D505N possibly damaging Het
Psmd13 T C 7: 140,897,648 V320A probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rere C A 4: 150,614,590 probably benign Het
Rint1 T C 5: 23,810,929 S456P possibly damaging Het
Scn3a T C 2: 65,520,866 Q446R possibly damaging Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Snrnp200 A G 2: 127,212,403 E210G possibly damaging Het
Snrnp200 A G 2: 127,237,883 T1891A probably benign Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Spin1 T C 13: 51,144,537 probably null Het
St14 T A 9: 31,091,373 I745F probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Uty T C Y: 1,169,193 E414G probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Wwc2 T C 8: 47,868,321 D586G unknown Het
Zfp106 T C 2: 120,523,529 H1490R probably benign Het
Zswim5 T C 4: 116,979,912 V731A probably benign Het
Zyg11b G C 4: 108,250,819 N463K possibly damaging Het
Other mutations in Hic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Hic1 APN 11 75165519 missense possibly damaging 0.96
cough UTSW 11 75166317 missense possibly damaging 0.93
Cup UTSW 11 75167374 missense probably damaging 0.97
Undulate UTSW 11 75166216 missense possibly damaging 0.96
R0138:Hic1 UTSW 11 75167343 missense probably damaging 0.99
R0331:Hic1 UTSW 11 75165490 missense possibly damaging 0.53
R0491:Hic1 UTSW 11 75166310 missense possibly damaging 0.86
R0521:Hic1 UTSW 11 75166887 missense possibly damaging 0.68
R0744:Hic1 UTSW 11 75165801 missense possibly damaging 0.52
R1766:Hic1 UTSW 11 75165794 nonsense probably null
R2211:Hic1 UTSW 11 75169384 missense possibly damaging 0.59
R5418:Hic1 UTSW 11 75166599 splice site probably null
R6047:Hic1 UTSW 11 75166849 missense possibly damaging 0.94
R6076:Hic1 UTSW 11 75167328 missense probably damaging 1.00
R6415:Hic1 UTSW 11 75166317 missense possibly damaging 0.93
R6633:Hic1 UTSW 11 75169498 missense unknown
R7122:Hic1 UTSW 11 75169230 missense probably benign
R7308:Hic1 UTSW 11 75167151 missense probably damaging 1.00
R7761:Hic1 UTSW 11 75167374 missense probably damaging 0.97
R7778:Hic1 UTSW 11 75166216 missense possibly damaging 0.96
R7824:Hic1 UTSW 11 75166216 missense possibly damaging 0.96
R8230:Hic1 UTSW 11 75165585 missense possibly damaging 0.85
R8419:Hic1 UTSW 11 75166270 missense possibly damaging 0.96
R8752:Hic1 UTSW 11 75169380 missense probably benign 0.00
R8832:Hic1 UTSW 11 75166902 missense possibly damaging 0.86
R8857:Hic1 UTSW 11 75165402 missense probably benign 0.33
R9068:Hic1 UTSW 11 75169506 missense unknown
R9157:Hic1 UTSW 11 75166227 missense possibly damaging 0.96
R9497:Hic1 UTSW 11 75169305 missense possibly damaging 0.92
R9594:Hic1 UTSW 11 75165931 missense possibly damaging 0.71
RF029:Hic1 UTSW 11 75169442 small deletion probably benign
RF043:Hic1 UTSW 11 75169455 small deletion probably benign
Z1186:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1187:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1188:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1189:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1190:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1191:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1191:Hic1 UTSW 11 75169448 frame shift probably null
Z1191:Hic1 UTSW 11 75169449 frame shift probably null
Z1191:Hic1 UTSW 11 75169450 small deletion probably benign
Z1192:Hic1 UTSW 11 75167526 missense probably damaging 0.99
Z1192:Hic1 UTSW 11 75169450 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CTAGGGAAGACACTTAGAGCCC -3'
(R):5'- GATATCTGAGTCTCCAGGTGGG -3'

Sequencing Primer
(F):5'- TTAGAGCCCCAAACGCCAG -3'
(R):5'- AAGATCTGCTCAGCTCCGC -3'
Posted On 2014-09-17