Incidental Mutation 'R2070:Oxsm'
ID227078
Institutional Source Beutler Lab
Gene Symbol Oxsm
Ensembl Gene ENSMUSG00000021786
Gene Name3-oxoacyl-ACP synthase, mitochondrial
Synonyms4933425A18Rik
MMRRC Submission 040075-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2070 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location16238652-16249808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16241983 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 262 (L262P)
Ref Sequence ENSEMBL: ENSMUSP00000108244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022311] [ENSMUST00000112624] [ENSMUST00000112625]
Predicted Effect probably benign
Transcript: ENSMUST00000022311
AA Change: L262P

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000022311
Gene: ENSMUSG00000021786
AA Change: L262P

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 6.7e-61 PFAM
Pfam:Ketoacyl-synt_C 299 414 3.6e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112624
AA Change: L262P

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108243
Gene: ENSMUSG00000021786
AA Change: L262P

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 2.8e-60 PFAM
Pfam:Ketoacyl-synt_C 299 414 1.7e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112625
AA Change: L262P

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000108244
Gene: ENSMUSG00000021786
AA Change: L262P

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 291 2.8e-60 PFAM
Pfam:Ketoacyl-synt_C 299 414 1.7e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148121
SMART Domains Protein: ENSMUSP00000122364
Gene: ENSMUSG00000021786

DomainStartEndE-ValueType
Pfam:ketoacyl-synt 41 198 9.2e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225889
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a beta-ketoacyl synthetase. The encoded enzyme is required for elongation of fatty acid chains in the mitochondria. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
4930548H24Rik T C 5: 31,487,383 V160A possibly damaging Het
9130011E15Rik G T 19: 45,891,285 P543Q probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Ablim2 G A 5: 35,798,513 C24Y probably damaging Het
Ankle1 T C 8: 71,409,344 F497S probably damaging Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bmi1 A G 2: 18,684,040 I207V probably benign Het
Bnip3l A G 14: 66,989,222 M174T probably damaging Het
Bora T C 14: 99,062,278 S229P probably damaging Het
Ccdc27 T A 4: 154,041,813 N73I unknown Het
Cdc42bpg T A 19: 6,320,488 C1204S probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cilp T A 9: 65,279,095 V824D probably damaging Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cntnap1 A G 11: 101,182,979 Y652C probably damaging Het
Col12a1 T C 9: 79,647,696 I2033M probably benign Het
Cwh43 T C 5: 73,421,517 L289P probably damaging Het
Ddhd1 T C 14: 45,610,624 D529G probably damaging Het
Defb28 T A 2: 152,520,144 S75T probably benign Het
Dennd2a A T 6: 39,465,119 V939D probably damaging Het
Dlg5 T C 14: 24,136,635 R1866G probably damaging Het
Dsc1 C T 18: 20,088,296 probably null Het
Ecscr T G 18: 35,715,437 N184T probably damaging Het
Eif4ebp1 G T 8: 27,273,344 R55L probably damaging Het
Eml1 G T 12: 108,512,999 V344L probably damaging Het
Exoc2 G T 13: 30,815,370 N901K probably benign Het
Fam161b T A 12: 84,356,428 I143F probably benign Het
Fam180a A G 6: 35,325,911 S2P probably benign Het
Fam57b T C 7: 126,819,840 L4P probably benign Het
Fat3 T A 9: 15,999,370 I1779F probably benign Het
Fat4 A G 3: 39,010,655 K4920R probably benign Het
Fsip2 T A 2: 82,976,355 V1006E probably damaging Het
Glcci1 A G 6: 8,558,566 S30G probably damaging Het
Gm13078 T G 4: 143,726,902 Y193* probably null Het
Gm5414 A T 15: 101,628,060 S43R possibly damaging Het
Hao1 T C 2: 134,530,615 T158A probably damaging Het
Hic1 T C 11: 75,169,059 H154R possibly damaging Het
Hmgxb3 T C 18: 61,171,359 Y53C probably damaging Het
Ipmk A T 10: 71,372,749 K122* probably null Het
Jakmip2 T C 18: 43,563,330 E518G probably benign Het
Kmt2e A G 5: 23,501,995 T1519A probably benign Het
Lfng T C 5: 140,612,595 I224T possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map4k5 C T 12: 69,816,337 V629I probably damaging Het
Med12l A G 3: 59,244,905 D1037G probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mptx2 A T 1: 173,274,578 Y181* probably null Het
Mrpl24 T C 3: 87,923,067 probably null Het
Myo5a A G 9: 75,181,984 E1132G probably benign Het
Nedd4l T G 18: 65,212,820 F814L probably damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Oit3 T G 10: 59,431,013 I224L probably benign Het
Pacs2 C T 12: 113,061,111 T407I probably damaging Het
Pard6g T C 18: 80,117,725 I351T probably benign Het
Pdcl2 A T 5: 76,324,991 probably null Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Phip T A 9: 82,875,299 I1607L probably benign Het
Plekhd1 C A 12: 80,692,907 S10* probably null Het
Prdm1 C T 10: 44,441,412 D505N possibly damaging Het
Psmd13 T C 7: 140,897,648 V320A probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rere C A 4: 150,614,590 probably benign Het
Rint1 T C 5: 23,810,929 S456P possibly damaging Het
Scn3a T C 2: 65,520,866 Q446R possibly damaging Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Snrnp200 A G 2: 127,212,403 E210G possibly damaging Het
Snrnp200 A G 2: 127,237,883 T1891A probably benign Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Spin1 T C 13: 51,144,537 probably null Het
St14 T A 9: 31,091,373 I745F probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Uty T C Y: 1,169,193 E414G probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Wwc2 T C 8: 47,868,321 D586G unknown Het
Zfp106 T C 2: 120,523,529 H1490R probably benign Het
Zswim5 T C 4: 116,979,912 V731A probably benign Het
Zyg11b G C 4: 108,250,819 N463K possibly damaging Het
Other mutations in Oxsm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Oxsm APN 14 16242076 missense probably damaging 1.00
IGL00900:Oxsm APN 14 16242023 missense probably damaging 0.96
IGL01966:Oxsm APN 14 16242520 missense probably benign
R0731:Oxsm UTSW 14 16240893 missense probably damaging 1.00
R2071:Oxsm UTSW 14 16241983 missense probably benign 0.03
R4172:Oxsm UTSW 14 16242079 missense probably damaging 1.00
R5473:Oxsm UTSW 14 16242045 missense probably damaging 1.00
R6048:Oxsm UTSW 14 16242308 missense possibly damaging 0.63
R6301:Oxsm UTSW 14 16242220 missense probably damaging 1.00
R6415:Oxsm UTSW 14 16241904 missense probably benign 0.12
R6662:Oxsm UTSW 14 16242287 missense probably benign 0.02
R7490:Oxsm UTSW 14 16241066 missense probably benign 0.34
R7782:Oxsm UTSW 14 16240925 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CAACCGTTCTTTACCTTAAAGCAC -3'
(R):5'- TCGCTACAAACTCAAGGGCC -3'

Sequencing Primer
(F):5'- AAAGCACCTTCTCCTTCGGG -3'
(R):5'- AGGGCCCCAATCACTCAGTG -3'
Posted On2014-09-17