Incidental Mutation 'R2070:Nedd4l'
ID227098
Institutional Source Beutler Lab
Gene Symbol Nedd4l
Ensembl Gene ENSMUSG00000024589
Gene Nameneural precursor cell expressed, developmentally down-regulated gene 4-like
SynonymsNedd4-2, Nedd4b, 1300012C07Rik
MMRRC Submission 040075-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.243) question?
Stock #R2070 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location64887705-65217831 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 65212820 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 814 (F814L)
Ref Sequence ENSEMBL: ENSMUSP00000153052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]
Predicted Effect probably damaging
Transcript: ENSMUST00000080418
AA Change: F834L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: F834L

DomainStartEndE-ValueType
PDB:3M7F|B 1 64 2e-21 PDB
WW 73 105 2.32e-13 SMART
low complexity region 139 154 N/A INTRINSIC
low complexity region 166 178 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
WW 266 298 2.08e-15 SMART
low complexity region 355 371 N/A INTRINSIC
WW 378 410 4.1e-14 SMART
WW 429 461 1.53e-13 SMART
HECTc 518 854 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000163516
AA Change: F955L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: F955L

DomainStartEndE-ValueType
C2 21 124 1.76e-25 SMART
WW 194 226 2.32e-13 SMART
low complexity region 260 275 N/A INTRINSIC
low complexity region 287 299 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
WW 387 419 2.08e-15 SMART
low complexity region 476 492 N/A INTRINSIC
WW 499 531 4.1e-14 SMART
WW 550 582 1.53e-13 SMART
HECTc 639 975 3.04e-183 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000224347
AA Change: F814L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224663
Predicted Effect probably damaging
Transcript: ENSMUST00000226058
AA Change: F834L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
4930548H24Rik T C 5: 31,487,383 V160A possibly damaging Het
9130011E15Rik G T 19: 45,891,285 P543Q probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Ablim2 G A 5: 35,798,513 C24Y probably damaging Het
Ankle1 T C 8: 71,409,344 F497S probably damaging Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bmi1 A G 2: 18,684,040 I207V probably benign Het
Bnip3l A G 14: 66,989,222 M174T probably damaging Het
Bora T C 14: 99,062,278 S229P probably damaging Het
Ccdc27 T A 4: 154,041,813 N73I unknown Het
Cdc42bpg T A 19: 6,320,488 C1204S probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cilp T A 9: 65,279,095 V824D probably damaging Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cntnap1 A G 11: 101,182,979 Y652C probably damaging Het
Col12a1 T C 9: 79,647,696 I2033M probably benign Het
Cwh43 T C 5: 73,421,517 L289P probably damaging Het
Ddhd1 T C 14: 45,610,624 D529G probably damaging Het
Defb28 T A 2: 152,520,144 S75T probably benign Het
Dennd2a A T 6: 39,465,119 V939D probably damaging Het
Dlg5 T C 14: 24,136,635 R1866G probably damaging Het
Dsc1 C T 18: 20,088,296 probably null Het
Ecscr T G 18: 35,715,437 N184T probably damaging Het
Eif4ebp1 G T 8: 27,273,344 R55L probably damaging Het
Eml1 G T 12: 108,512,999 V344L probably damaging Het
Exoc2 G T 13: 30,815,370 N901K probably benign Het
Fam161b T A 12: 84,356,428 I143F probably benign Het
Fam180a A G 6: 35,325,911 S2P probably benign Het
Fam57b T C 7: 126,819,840 L4P probably benign Het
Fat3 T A 9: 15,999,370 I1779F probably benign Het
Fat4 A G 3: 39,010,655 K4920R probably benign Het
Fsip2 T A 2: 82,976,355 V1006E probably damaging Het
Glcci1 A G 6: 8,558,566 S30G probably damaging Het
Gm13078 T G 4: 143,726,902 Y193* probably null Het
Gm5414 A T 15: 101,628,060 S43R possibly damaging Het
Hao1 T C 2: 134,530,615 T158A probably damaging Het
Hic1 T C 11: 75,169,059 H154R possibly damaging Het
Hmgxb3 T C 18: 61,171,359 Y53C probably damaging Het
Ipmk A T 10: 71,372,749 K122* probably null Het
Jakmip2 T C 18: 43,563,330 E518G probably benign Het
Kmt2e A G 5: 23,501,995 T1519A probably benign Het
Lfng T C 5: 140,612,595 I224T possibly damaging Het
Magel2 G A 7: 62,379,096 V583I unknown Het
Map4k5 C T 12: 69,816,337 V629I probably damaging Het
Med12l A G 3: 59,244,905 D1037G probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mptx2 A T 1: 173,274,578 Y181* probably null Het
Mrpl24 T C 3: 87,923,067 probably null Het
Myo5a A G 9: 75,181,984 E1132G probably benign Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Oit3 T G 10: 59,431,013 I224L probably benign Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pacs2 C T 12: 113,061,111 T407I probably damaging Het
Pard6g T C 18: 80,117,725 I351T probably benign Het
Pdcl2 A T 5: 76,324,991 probably null Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Phip T A 9: 82,875,299 I1607L probably benign Het
Plekhd1 C A 12: 80,692,907 S10* probably null Het
Prdm1 C T 10: 44,441,412 D505N possibly damaging Het
Psmd13 T C 7: 140,897,648 V320A probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rere C A 4: 150,614,590 probably benign Het
Rint1 T C 5: 23,810,929 S456P possibly damaging Het
Scn3a T C 2: 65,520,866 Q446R possibly damaging Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Snrnp200 A G 2: 127,212,403 E210G possibly damaging Het
Snrnp200 A G 2: 127,237,883 T1891A probably benign Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Spin1 T C 13: 51,144,537 probably null Het
St14 T A 9: 31,091,373 I745F probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Uty T C Y: 1,169,193 E414G probably benign Het
Wrap73 T A 4: 154,148,743 S125T possibly damaging Het
Wwc2 T C 8: 47,868,321 D586G unknown Het
Zfp106 T C 2: 120,523,529 H1490R probably benign Het
Zswim5 T C 4: 116,979,912 V731A probably benign Het
Zyg11b G C 4: 108,250,819 N463K possibly damaging Het
Other mutations in Nedd4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Nedd4l APN 18 65208092 missense probably damaging 1.00
IGL00931:Nedd4l APN 18 65172399 missense possibly damaging 0.57
IGL02306:Nedd4l APN 18 65172954 missense possibly damaging 0.64
IGL02363:Nedd4l APN 18 65208045 splice site probably benign
IGL02440:Nedd4l APN 18 65163173 critical splice donor site probably null
IGL02444:Nedd4l APN 18 65203957 splice site probably benign
IGL02700:Nedd4l APN 18 65209680 missense probably damaging 1.00
IGL02943:Nedd4l APN 18 65161652 critical splice donor site probably null
IGL02999:Nedd4l APN 18 65198707 missense probably damaging 1.00
IGL03135:Nedd4l APN 18 65205670 missense probably damaging 1.00
IGL03373:Nedd4l APN 18 65181320 splice site probably benign
R0036:Nedd4l UTSW 18 65051123 intron probably benign
R0396:Nedd4l UTSW 18 65161654 splice site probably benign
R0472:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0494:Nedd4l UTSW 18 65173021 missense possibly damaging 0.69
R0513:Nedd4l UTSW 18 65195185 splice site probably benign
R0609:Nedd4l UTSW 18 65208461 missense probably damaging 1.00
R0631:Nedd4l UTSW 18 65208503 splice site probably benign
R1077:Nedd4l UTSW 18 65167499 splice site probably benign
R1643:Nedd4l UTSW 18 65198641 missense probably damaging 1.00
R1722:Nedd4l UTSW 18 65157939 missense probably damaging 1.00
R1806:Nedd4l UTSW 18 65212791 missense probably damaging 1.00
R1921:Nedd4l UTSW 18 65167575 critical splice donor site probably null
R1986:Nedd4l UTSW 18 65143803 missense probably damaging 1.00
R2151:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2152:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2154:Nedd4l UTSW 18 65210330 missense probably damaging 1.00
R2358:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R2680:Nedd4l UTSW 18 65163130 missense possibly damaging 0.85
R3082:Nedd4l UTSW 18 65178978 missense probably benign 0.00
R3500:Nedd4l UTSW 18 65212860 missense probably damaging 1.00
R3711:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3712:Nedd4l UTSW 18 65209719 missense possibly damaging 0.51
R3874:Nedd4l UTSW 18 65167535 missense probably benign
R4435:Nedd4l UTSW 18 65212825 missense possibly damaging 0.84
R4698:Nedd4l UTSW 18 65203880 missense probably damaging 1.00
R4757:Nedd4l UTSW 18 65165605 missense probably damaging 0.98
R4783:Nedd4l UTSW 18 65172927 missense probably damaging 0.99
R4790:Nedd4l UTSW 18 65203945 missense possibly damaging 0.94
R4980:Nedd4l UTSW 18 65080060 nonsense probably null
R5106:Nedd4l UTSW 18 65193305 missense probably damaging 1.00
R5122:Nedd4l UTSW 18 65191447 missense probably damaging 1.00
R5605:Nedd4l UTSW 18 65174244 critical splice donor site probably null
R6465:Nedd4l UTSW 18 65155264 missense probably benign 0.06
R6479:Nedd4l UTSW 18 65209681 missense probably damaging 1.00
R6622:Nedd4l UTSW 18 65174234 missense probably damaging 0.99
R6773:Nedd4l UTSW 18 65167551 missense probably benign 0.36
R7065:Nedd4l UTSW 18 65195969 missense probably benign 0.04
R7068:Nedd4l UTSW 18 65205651 missense probably damaging 1.00
R7193:Nedd4l UTSW 18 64997370 missense probably damaging 1.00
R7496:Nedd4l UTSW 18 65080018 missense possibly damaging 0.94
R7903:Nedd4l UTSW 18 65186367 missense probably damaging 1.00
R8123:Nedd4l UTSW 18 65074774 missense probably damaging 1.00
R8185:Nedd4l UTSW 18 65209698 missense probably damaging 1.00
R8282:Nedd4l UTSW 18 65191489 missense probably damaging 0.98
R8440:Nedd4l UTSW 18 64889055 splice site probably null
R8499:Nedd4l UTSW 18 65209657 missense probably damaging 0.98
R8557:Nedd4l UTSW 18 65203915 missense probably benign 0.00
R8801:Nedd4l UTSW 18 65155275 missense probably damaging 1.00
RF013:Nedd4l UTSW 18 65209680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATAGGCACTGTCATAGCTAG -3'
(R):5'- CCAGTTGAGAATTGGCGGTG -3'

Sequencing Primer
(F):5'- GCACTGTCATAGCTAGAATTTGGC -3'
(R):5'- TGGCGGAACTTGGGCAG -3'
Posted On2014-09-17