Mutagenetix > Incidental Mutation

Incidental Mutation 'R2070:Nedd4l'

227098

Institutional Source

Beutler Lab

Gene Symbol

Nedd4l

Ensembl Gene

ENSMUSG00000024589

Gene Name

neural precursor cell expressed, developmentally down-regulated gene 4-like

Synonyms

Nedd4-2, Nedd4b, 1300012C07Rik

MMRRC Submission

040075-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.224) question?

Stock #

R2070 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

64887705-65217831 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 65212820 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 814 (F814L)

Ref Sequence

ENSEMBL: ENSMUSP00000153052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080418] [ENSMUST00000163516] [ENSMUST00000224347] [ENSMUST00000226058]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080418
AA Change: F834L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000079280
Gene: ENSMUSG00000024589
AA Change: F834L

Domain	Start	End	E-Value	Type
PDB:3M7F\|B	1	64	2e-21	PDB
WW	73	105	2.32e-13	SMART
low complexity region	139	154	N/A	INTRINSIC
low complexity region	166	178	N/A	INTRINSIC
low complexity region	234	247	N/A	INTRINSIC
WW	266	298	2.08e-15	SMART
low complexity region	355	371	N/A	INTRINSIC
WW	378	410	4.1e-14	SMART
WW	429	461	1.53e-13	SMART
HECTc	518	854	3.04e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000163516
AA Change: F955L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132838
Gene: ENSMUSG00000024589
AA Change: F955L

Domain	Start	End	E-Value	Type
C2	21	124	1.76e-25	SMART
WW	194	226	2.32e-13	SMART
low complexity region	260	275	N/A	INTRINSIC
low complexity region	287	299	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
WW	387	419	2.08e-15	SMART
low complexity region	476	492	N/A	INTRINSIC
WW	499	531	4.1e-14	SMART
WW	550	582	1.53e-13	SMART
HECTc	639	975	3.04e-183	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000224347
AA Change: F814L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224663

Predicted Effect

probably damaging
Transcript: ENSMUST00000226058
AA Change: F834L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein mediates the ubiquitination of multiple target substrates and plays a critical role in epithelial sodium transport by regulating the cell surface expression of the epithelial sodium channel, ENaC. Single nucleotide polymorphisms in this gene may be associated with essential hypertension. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a null mutation display salt sensitive hypertension and high salt diet induced cardiac hypertrophy. A spontaneous mutation results in overt diabetes insipidus. Mice homozygous for a knock-out allele exhibit neonatal lethality with primary atelectasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	A	G	11: 58,876,769	K31E	probably damaging	Het
4930548H24Rik	T	C	5: 31,487,383	V160A	possibly damaging	Het
9130011E15Rik	G	T	19: 45,891,285	P543Q	probably damaging	Het
Abcc10	G	C	17: 46,303,565	N1477K	probably benign	Het
Ablim2	G	A	5: 35,798,513	C24Y	probably damaging	Het
Ankle1	T	C	8: 71,409,344	F497S	probably damaging	Het
Ash1l	C	G	3: 88,966,203	P98A	probably damaging	Het
Atad5	A	T	11: 80,098,052		probably null	Het
B3gnt4	A	T	5: 123,511,370	H266L	probably benign	Het
Bmi1	A	G	2: 18,684,040	I207V	probably benign	Het
Bnip3l	A	G	14: 66,989,222	M174T	probably damaging	Het
Bora	T	C	14: 99,062,278	S229P	probably damaging	Het
Ccdc27	T	A	4: 154,041,813	N73I	unknown	Het
Cdc42bpg	T	A	19: 6,320,488	C1204S	probably damaging	Het
Cdsn	A	T	17: 35,554,694	D40V	probably damaging	Het
Cilp	T	A	9: 65,279,095	V824D	probably damaging	Het
Cmtr1	A	G	17: 29,694,783		probably null	Het
Cntnap1	A	G	11: 101,182,979	Y652C	probably damaging	Het
Col12a1	T	C	9: 79,647,696	I2033M	probably benign	Het
Cwh43	T	C	5: 73,421,517	L289P	probably damaging	Het
Ddhd1	T	C	14: 45,610,624	D529G	probably damaging	Het
Defb28	T	A	2: 152,520,144	S75T	probably benign	Het
Dennd2a	A	T	6: 39,465,119	V939D	probably damaging	Het
Dlg5	T	C	14: 24,136,635	R1866G	probably damaging	Het
Dsc1	C	T	18: 20,088,296		probably null	Het
Ecscr	T	G	18: 35,715,437	N184T	probably damaging	Het
Eif4ebp1	G	T	8: 27,273,344	R55L	probably damaging	Het
Eml1	G	T	12: 108,512,999	V344L	probably damaging	Het
Exoc2	G	T	13: 30,815,370	N901K	probably benign	Het
Fam161b	T	A	12: 84,356,428	I143F	probably benign	Het
Fam180a	A	G	6: 35,325,911	S2P	probably benign	Het
Fam57b	T	C	7: 126,819,840	L4P	probably benign	Het
Fat3	T	A	9: 15,999,370	I1779F	probably benign	Het
Fat4	A	G	3: 39,010,655	K4920R	probably benign	Het
Fsip2	T	A	2: 82,976,355	V1006E	probably damaging	Het
Glcci1	A	G	6: 8,558,566	S30G	probably damaging	Het
Gm13078	T	G	4: 143,726,902	Y193*	probably null	Het
Gm5414	A	T	15: 101,628,060	S43R	possibly damaging	Het
Hao1	T	C	2: 134,530,615	T158A	probably damaging	Het
Hic1	T	C	11: 75,169,059	H154R	possibly damaging	Het
Hmgxb3	T	C	18: 61,171,359	Y53C	probably damaging	Het
Ipmk	A	T	10: 71,372,749	K122*	probably null	Het
Jakmip2	T	C	18: 43,563,330	E518G	probably benign	Het
Kmt2e	A	G	5: 23,501,995	T1519A	probably benign	Het
Lfng	T	C	5: 140,612,595	I224T	possibly damaging	Het
Magel2	G	A	7: 62,379,096	V583I	unknown	Het
Map4k5	C	T	12: 69,816,337	V629I	probably damaging	Het
Med12l	A	G	3: 59,244,905	D1037G	probably damaging	Het
Morc1	C	T	16: 48,592,611	T705I	probably benign	Het
Mptx2	A	T	1: 173,274,578	Y181*	probably null	Het
Mrpl24	T	C	3: 87,923,067		probably null	Het
Myo5a	A	G	9: 75,181,984	E1132G	probably benign	Het
Nmral1	T	A	16: 4,716,347	I77F	probably damaging	Het
Oit3	T	G	10: 59,431,013	I224L	probably benign	Het
Oxsm	A	G	14: 16,241,983	L262P	probably benign	Het
Pacs2	C	T	12: 113,061,111	T407I	probably damaging	Het
Pard6g	T	C	18: 80,117,725	I351T	probably benign	Het
Pdcl2	A	T	5: 76,324,991		probably null	Het
Pdzph1	T	C	17: 58,974,097	R397G	probably benign	Het
Phip	T	A	9: 82,875,299	I1607L	probably benign	Het
Plekhd1	C	A	12: 80,692,907	S10*	probably null	Het
Prdm1	C	T	10: 44,441,412	D505N	possibly damaging	Het
Psmd13	T	C	7: 140,897,648	V320A	probably damaging	Het
Rbak	A	G	5: 143,176,584	L8P	probably damaging	Het
Rere	C	A	4: 150,614,590		probably benign	Het
Rint1	T	C	5: 23,810,929	S456P	possibly damaging	Het
Scn3a	T	C	2: 65,520,866	Q446R	possibly damaging	Het
Slitrk5	A	G	14: 111,680,189	Y415C	probably damaging	Het
Snrnp200	A	G	2: 127,212,403	E210G	possibly damaging	Het
Snrnp200	A	G	2: 127,237,883	T1891A	probably benign	Het
Sohlh2	A	G	3: 55,207,622	I343V	probably benign	Het
Spin1	T	C	13: 51,144,537		probably null	Het
St14	T	A	9: 31,091,373	I745F	probably damaging	Het
Sv2a	G	A	3: 96,193,875	A730T	possibly damaging	Het
Tars2	C	A	3: 95,747,638	G113C	probably damaging	Het
Trp53	A	G	11: 69,589,632	D278G	probably damaging	Het
Ubxn7	T	A	16: 32,372,469	C160S	possibly damaging	Het
Uty	T	C	Y: 1,169,193	E414G	probably benign	Het
Wrap73	T	A	4: 154,148,743	S125T	possibly damaging	Het
Wwc2	T	C	8: 47,868,321	D586G	unknown	Het
Zfp106	T	C	2: 120,523,529	H1490R	probably benign	Het
Zswim5	T	C	4: 116,979,912	V731A	probably benign	Het
Zyg11b	G	C	4: 108,250,819	N463K	possibly damaging	Het

Other mutations in Nedd4l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Nedd4l	APN	18	65208092	missense	probably damaging	1.00
IGL00931:Nedd4l	APN	18	65172399	missense	possibly damaging	0.57
IGL02306:Nedd4l	APN	18	65172954	missense	possibly damaging	0.64
IGL02363:Nedd4l	APN	18	65208045	splice site	probably benign
IGL02440:Nedd4l	APN	18	65163173	critical splice donor site	probably null
IGL02444:Nedd4l	APN	18	65203957	splice site	probably benign
IGL02700:Nedd4l	APN	18	65209680	missense	probably damaging	1.00
IGL02943:Nedd4l	APN	18	65161652	critical splice donor site	probably null
IGL02999:Nedd4l	APN	18	65198707	missense	probably damaging	1.00
IGL03135:Nedd4l	APN	18	65205670	missense	probably damaging	1.00
IGL03373:Nedd4l	APN	18	65181320	splice site	probably benign
R0036:Nedd4l	UTSW	18	65051123	intron	probably benign
R0396:Nedd4l	UTSW	18	65161654	splice site	probably benign
R0472:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0494:Nedd4l	UTSW	18	65173021	missense	possibly damaging	0.69
R0513:Nedd4l	UTSW	18	65195185	splice site	probably benign
R0609:Nedd4l	UTSW	18	65208461	missense	probably damaging	1.00
R0631:Nedd4l	UTSW	18	65208503	splice site	probably benign
R1077:Nedd4l	UTSW	18	65167499	splice site	probably benign
R1643:Nedd4l	UTSW	18	65198641	missense	probably damaging	1.00
R1722:Nedd4l	UTSW	18	65157939	missense	probably damaging	1.00
R1806:Nedd4l	UTSW	18	65212791	missense	probably damaging	1.00
R1921:Nedd4l	UTSW	18	65167575	critical splice donor site	probably null
R1986:Nedd4l	UTSW	18	65143803	missense	probably damaging	1.00
R2151:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2152:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2154:Nedd4l	UTSW	18	65210330	missense	probably damaging	1.00
R2358:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R2680:Nedd4l	UTSW	18	65163130	missense	possibly damaging	0.85
R3082:Nedd4l	UTSW	18	65178978	missense	probably benign	0.00
R3500:Nedd4l	UTSW	18	65212860	missense	probably damaging	1.00
R3711:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3712:Nedd4l	UTSW	18	65209719	missense	possibly damaging	0.51
R3874:Nedd4l	UTSW	18	65167535	missense	probably benign
R4435:Nedd4l	UTSW	18	65212825	missense	possibly damaging	0.84
R4698:Nedd4l	UTSW	18	65203880	missense	probably damaging	1.00
R4757:Nedd4l	UTSW	18	65165605	missense	probably damaging	0.98
R4783:Nedd4l	UTSW	18	65172927	missense	probably damaging	0.99
R4790:Nedd4l	UTSW	18	65203945	missense	possibly damaging	0.94
R4980:Nedd4l	UTSW	18	65080060	nonsense	probably null
R5106:Nedd4l	UTSW	18	65193305	missense	probably damaging	1.00
R5122:Nedd4l	UTSW	18	65191447	missense	probably damaging	1.00
R5605:Nedd4l	UTSW	18	65174244	critical splice donor site	probably null
R6465:Nedd4l	UTSW	18	65155264	missense	probably benign	0.06
R6479:Nedd4l	UTSW	18	65209681	missense	probably damaging	1.00
R6622:Nedd4l	UTSW	18	65174234	missense	probably damaging	0.99
R6773:Nedd4l	UTSW	18	65167551	missense	probably benign	0.36
R7065:Nedd4l	UTSW	18	65195969	missense	probably benign	0.04
R7068:Nedd4l	UTSW	18	65205651	missense	probably damaging	1.00
R7193:Nedd4l	UTSW	18	64997370	missense	probably damaging	1.00
R7496:Nedd4l	UTSW	18	65080018	missense	possibly damaging	0.94
R7903:Nedd4l	UTSW	18	65186367	missense	probably damaging	1.00
R8123:Nedd4l	UTSW	18	65074774	missense	probably damaging	1.00
R8185:Nedd4l	UTSW	18	65209698	missense	probably damaging	1.00
R8282:Nedd4l	UTSW	18	65191489	missense	probably damaging	0.98
R8440:Nedd4l	UTSW	18	64889055	splice site	probably null
R8499:Nedd4l	UTSW	18	65209657	missense	probably damaging	0.98
R8557:Nedd4l	UTSW	18	65203915	missense	probably benign	0.00
R8801:Nedd4l	UTSW	18	65155275	missense	probably damaging	1.00
R8896:Nedd4l	UTSW	18	65165617	missense	probably benign
R9025:Nedd4l	UTSW	18	65178924	missense	probably damaging	0.98
R9040:Nedd4l	UTSW	18	65209663	missense	probably damaging	0.99
R9482:Nedd4l	UTSW	18	64887960	unclassified	probably benign
R9498:Nedd4l	UTSW	18	65161652	critical splice donor site	probably null
R9599:Nedd4l	UTSW	18	65210329	missense	probably damaging	1.00
RF013:Nedd4l	UTSW	18	65209680	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATAGGCACTGTCATAGCTAG -3'
(R):5'- CCAGTTGAGAATTGGCGGTG -3'

Sequencing Primer
(F):5'- GCACTGTCATAGCTAGAATTTGGC -3'
(R):5'- TGGCGGAACTTGGGCAG -3'

Posted On

2014-09-17