Incidental Mutation 'R0149:Sdk1'
ID22710
Institutional Source Beutler Lab
Gene Symbol Sdk1
Ensembl Gene ENSMUSG00000039683
Gene Namesidekick cell adhesion molecule 1
Synonyms6720466O15Rik
MMRRC Submission 038433-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R0149 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location141241490-142215586 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 141857054 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074546] [ENSMUST00000085774]
Predicted Effect probably benign
Transcript: ENSMUST00000074546
SMART Domains Protein: ENSMUSP00000074133
Gene: ENSMUSG00000039683

DomainStartEndE-ValueType
IGc2 28 91 4.67e-4 SMART
IGc2 121 187 1.45e-9 SMART
IGc2 214 282 1.58e-10 SMART
IG 302 387 1.8e-5 SMART
FN3 390 474 7.39e-14 SMART
FN3 490 576 8.96e-13 SMART
FN3 591 679 1.95e-4 SMART
FN3 694 776 2e-10 SMART
FN3 792 879 4.22e-9 SMART
FN3 896 983 1.41e-10 SMART
FN3 999 1084 2.7e-7 SMART
FN3 1100 1183 1.3e-9 SMART
FN3 1199 1284 2.19e-7 SMART
FN3 1300 1408 5.73e-11 SMART
FN3 1424 1509 1.79e-12 SMART
FN3 1524 1611 1.16e-11 SMART
FN3 1625 1709 1.32e-10 SMART
transmembrane domain 1730 1752 N/A INTRINSIC
low complexity region 1806 1815 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085774
SMART Domains Protein: ENSMUSP00000082928
Gene: ENSMUSG00000039683

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
IGc2 99 158 2.77e-6 SMART
IG 179 264 3.74e-3 SMART
IGc2 288 351 4.67e-4 SMART
IGc2 381 447 1.45e-9 SMART
IGc2 474 542 1.58e-10 SMART
IG 562 647 1.8e-5 SMART
FN3 650 734 7.39e-14 SMART
FN3 750 836 8.96e-13 SMART
FN3 851 939 1.95e-4 SMART
FN3 954 1036 2e-10 SMART
FN3 1052 1139 4.22e-9 SMART
FN3 1156 1243 1.41e-10 SMART
FN3 1259 1344 2.7e-7 SMART
FN3 1360 1443 1.3e-9 SMART
FN3 1459 1544 2.19e-7 SMART
FN3 1560 1668 5.73e-11 SMART
FN3 1684 1769 1.79e-12 SMART
FN3 1784 1871 1.16e-11 SMART
FN3 1885 1969 1.32e-10 SMART
transmembrane domain 1990 2012 N/A INTRINSIC
low complexity region 2066 2075 N/A INTRINSIC
low complexity region 2106 2118 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145908
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.5%
Validation Efficiency 97% (84/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains six immunoglobulin-like domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A230072I06Rik A C 8: 12,280,000 S152R unknown Het
Acsbg2 A G 17: 56,853,924 probably benign Het
Adam6a G T 12: 113,545,749 V581F probably damaging Het
Adgrl3 A T 5: 81,760,697 I1165F probably damaging Het
Aldh1l1 A G 6: 90,589,414 K656E possibly damaging Het
Ankhd1 T C 18: 36,647,214 I1773T probably damaging Het
Api5 A T 2: 94,423,497 L287* probably null Het
Ascc3 A T 10: 50,607,993 N55I probably benign Het
Cav1 C A 6: 17,339,353 R146S possibly damaging Het
Cdhr2 A T 13: 54,734,007 I1118F probably damaging Het
Cemip A G 7: 83,964,010 I660T probably benign Het
Clk1 T A 1: 58,414,601 N305Y probably damaging Het
Cux1 T A 5: 136,279,497 I1263F probably damaging Het
Cyp2d26 A G 15: 82,792,767 L152P probably damaging Het
Dmtf1 A G 5: 9,132,571 S188P probably damaging Het
Dock2 A G 11: 34,438,327 L202P probably damaging Het
Dscaml1 T G 9: 45,742,680 Y1418* probably null Het
Efemp2 A T 19: 5,477,960 H107L probably damaging Het
Eng T C 2: 32,672,385 probably null Het
Erc1 A T 6: 119,824,830 S75R probably damaging Het
Fgl2 A T 5: 21,375,785 D375V probably damaging Het
Fpr-rs6 T C 17: 20,182,213 I295M probably benign Het
Fsip2 T C 2: 82,975,505 S723P possibly damaging Het
Gdpd5 A G 7: 99,458,790 I530V possibly damaging Het
Gm15217 T A 14: 46,380,384 probably benign Het
Gm4922 T C 10: 18,783,541 T478A probably benign Het
Gm6614 T C 6: 141,992,477 T239A probably benign Het
Gmcl1 A T 6: 86,732,909 probably null Het
Has1 T C 17: 17,850,171 T163A probably damaging Het
Hmcn1 A T 1: 150,677,324 N2538K probably benign Het
Itga2 A G 13: 114,836,579 probably benign Het
Kcnip1 A T 11: 33,843,177 M5K probably benign Het
Kcnk4 T C 19: 6,926,194 E329G probably benign Het
Kcnt1 T C 2: 25,898,264 probably benign Het
Klkb1 A G 8: 45,276,063 C375R probably damaging Het
Loxl2 C A 14: 69,693,078 H764N probably benign Het
Lrrc55 A T 2: 85,196,245 M145K probably damaging Het
Lrrtm2 A G 18: 35,212,932 I439T probably benign Het
Magi1 A T 6: 93,747,245 I263N probably damaging Het
Map4 C T 9: 110,067,624 P641L probably damaging Het
Mars A T 10: 127,300,034 N558K probably damaging Het
Mfap2 A G 4: 141,014,983 D98G probably damaging Het
Mgat5b A G 11: 116,985,139 probably benign Het
Mki67 A T 7: 135,698,424 V1627D probably benign Het
Mtnr1a A T 8: 45,069,315 I36F probably benign Het
Myh15 A T 16: 49,114,005 N645I probably benign Het
Myo7b T A 18: 32,014,209 I94F probably damaging Het
Nefh A T 11: 4,940,799 S607T probably benign Het
Ngf T A 3: 102,520,446 H174Q probably benign Het
Noa1 G A 5: 77,297,173 Q600* probably null Het
Nr2f2 A G 7: 70,358,062 V71A possibly damaging Het
Oas2 A T 5: 120,738,401 F492L probably damaging Het
Olfr1390 A T 11: 49,340,814 Y94F probably benign Het
Olfr935 T A 9: 38,994,584 M284L probably benign Het
Osmr A G 15: 6,841,951 probably null Het
P4ha1 A G 10: 59,348,399 T228A probably damaging Het
Pip5kl1 T C 2: 32,578,954 V195A possibly damaging Het
Plagl2 A T 2: 153,231,603 D459E probably benign Het
Plxna1 T C 6: 89,320,613 E1863G probably null Het
Prdm10 T G 9: 31,316,159 probably benign Het
Prr14l A C 5: 32,793,641 L1936R probably damaging Het
Rgs1 T C 1: 144,249,087 probably benign Het
Rgsl1 A G 1: 153,793,764 F292S probably damaging Het
Rhobtb2 T C 14: 69,795,908 T538A probably benign Het
Rictor A G 15: 6,784,107 N1025D possibly damaging Het
Rsph10b T A 5: 143,938,909 probably benign Het
Rwdd4a A G 8: 47,544,220 D158G probably null Het
Serpina3n A C 12: 104,411,376 K296T probably benign Het
Snw1 A G 12: 87,461,917 V124A possibly damaging Het
Tas2r137 T G 6: 40,491,298 F21V probably benign Het
Tmc6 G A 11: 117,769,448 L655F probably damaging Het
Tmem260 A T 14: 48,452,047 T108S possibly damaging Het
Trim2 T C 3: 84,190,776 Y406C probably damaging Het
Tsc1 T C 2: 28,670,901 I257T probably damaging Het
Ttn T C 2: 76,843,402 probably benign Het
Unc80 T A 1: 66,521,601 N829K possibly damaging Het
Vmn1r235 A C 17: 21,261,995 D194A probably damaging Het
Vmn2r100 A T 17: 19,521,247 probably null Het
Ylpm1 G T 12: 85,028,838 R321L probably damaging Het
Zan T C 5: 137,396,766 T4381A unknown Het
Zfp457 A G 13: 67,292,646 F622L probably damaging Het
Zfy1 T C Y: 726,121 H548R possibly damaging Het
Zmym4 A T 4: 126,911,145 S441T probably benign Het
Other mutations in Sdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Sdk1 APN 5 142085606 missense probably damaging 1.00
IGL00945:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL00946:Sdk1 APN 5 142084613 critical splice donor site probably null
IGL01394:Sdk1 APN 5 141613215 missense probably benign 0.03
IGL01398:Sdk1 APN 5 141937577 missense probably benign 0.00
IGL01410:Sdk1 APN 5 142212120 missense probably benign 0.30
IGL01525:Sdk1 APN 5 141999920 missense probably damaging 1.00
IGL01548:Sdk1 APN 5 142085765 missense possibly damaging 0.95
IGL01672:Sdk1 APN 5 142185175 missense probably benign 0.33
IGL01676:Sdk1 APN 5 142127836 missense probably damaging 0.99
IGL01679:Sdk1 APN 5 142046164 missense probably benign
IGL01929:Sdk1 APN 5 141953030 missense probably damaging 0.99
IGL01970:Sdk1 APN 5 142085682 missense possibly damaging 0.67
IGL02016:Sdk1 APN 5 142034429 missense possibly damaging 0.85
IGL02060:Sdk1 APN 5 141953012 missense possibly damaging 0.79
IGL02457:Sdk1 APN 5 141953016 missense probably damaging 1.00
IGL02634:Sdk1 APN 5 141610032 missense probably benign 0.01
IGL02637:Sdk1 APN 5 142094572 missense probably damaging 1.00
IGL02731:Sdk1 APN 5 142172544 missense probably damaging 1.00
IGL03180:Sdk1 APN 5 142085742 missense probably damaging 0.96
IGL03259:Sdk1 APN 5 141953033 nonsense probably null
PIT4453001:Sdk1 UTSW 5 142212038 missense probably benign 0.00
PIT4544001:Sdk1 UTSW 5 141956232 missense probably benign 0.08
R0173:Sdk1 UTSW 5 142173809 splice site probably benign
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0240:Sdk1 UTSW 5 141998747 missense probably damaging 1.00
R0242:Sdk1 UTSW 5 142143922 splice site probably benign
R0245:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0270:Sdk1 UTSW 5 142084566 missense possibly damaging 0.79
R0398:Sdk1 UTSW 5 141962721 missense probably benign 0.05
R0401:Sdk1 UTSW 5 142046161 missense possibly damaging 0.55
R0501:Sdk1 UTSW 5 141937718 missense probably benign
R0558:Sdk1 UTSW 5 142132065 missense probably damaging 1.00
R0652:Sdk1 UTSW 5 141954958 missense probably benign 0.02
R0834:Sdk1 UTSW 5 141242024 missense probably benign
R0962:Sdk1 UTSW 5 142161875 missense probably damaging 1.00
R1424:Sdk1 UTSW 5 142161866 missense probably damaging 1.00
R1438:Sdk1 UTSW 5 142038323 missense probably damaging 0.96
R1517:Sdk1 UTSW 5 142127836 missense probably damaging 0.99
R1519:Sdk1 UTSW 5 141999950 missense probably benign 0.00
R1539:Sdk1 UTSW 5 142094599 missense probably damaging 1.00
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1574:Sdk1 UTSW 5 141998879 missense probably benign 0.03
R1673:Sdk1 UTSW 5 141948506 missense possibly damaging 0.90
R1686:Sdk1 UTSW 5 142034537 missense probably benign 0.00
R1806:Sdk1 UTSW 5 141613195 missense probably damaging 1.00
R1806:Sdk1 UTSW 5 142161926 missense probably benign
R1925:Sdk1 UTSW 5 142185285 missense probably benign 0.09
R1956:Sdk1 UTSW 5 142094581 missense probably damaging 1.00
R1976:Sdk1 UTSW 5 142143818 missense probably damaging 1.00
R2124:Sdk1 UTSW 5 142185188 missense possibly damaging 0.70
R2152:Sdk1 UTSW 5 141792944 missense probably damaging 1.00
R2186:Sdk1 UTSW 5 142046292 missense probably benign 0.00
R2187:Sdk1 UTSW 5 142114574 missense probably damaging 1.00
R2306:Sdk1 UTSW 5 141962700 missense probably benign 0.00
R2520:Sdk1 UTSW 5 142085771 missense probably benign 0.19
R2698:Sdk1 UTSW 5 142212050 missense possibly damaging 0.95
R2763:Sdk1 UTSW 5 142084551 missense possibly damaging 0.90
R3023:Sdk1 UTSW 5 142046236 missense probably benign
R3500:Sdk1 UTSW 5 142006616 splice site probably benign
R3613:Sdk1 UTSW 5 142119686 missense probably damaging 1.00
R3824:Sdk1 UTSW 5 141936049 missense probably benign
R3916:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R3917:Sdk1 UTSW 5 142051244 missense probably damaging 0.98
R4158:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4160:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4161:Sdk1 UTSW 5 142114399 missense probably benign 0.00
R4386:Sdk1 UTSW 5 142094626 missense probably damaging 0.99
R4649:Sdk1 UTSW 5 142006625 missense probably damaging 1.00
R4701:Sdk1 UTSW 5 142185231 missense probably damaging 1.00
R4780:Sdk1 UTSW 5 141959238 missense probably damaging 0.97
R4787:Sdk1 UTSW 5 141582413 missense probably benign
R4825:Sdk1 UTSW 5 141582294 missense probably benign 0.11
R4853:Sdk1 UTSW 5 142146263 missense probably damaging 1.00
R4857:Sdk1 UTSW 5 142161776 missense probably benign 0.01
R4928:Sdk1 UTSW 5 141857003 intron probably benign
R5111:Sdk1 UTSW 5 142127845 missense probably damaging 1.00
R5188:Sdk1 UTSW 5 141956260 critical splice donor site probably null
R5246:Sdk1 UTSW 5 142114562 missense possibly damaging 0.72
R5273:Sdk1 UTSW 5 141998828 missense probably damaging 0.99
R5484:Sdk1 UTSW 5 142100186 missense probably damaging 1.00
R5525:Sdk1 UTSW 5 142185265 missense possibly damaging 0.84
R5578:Sdk1 UTSW 5 141613125 nonsense probably null
R5593:Sdk1 UTSW 5 141956124 missense probably damaging 0.98
R5654:Sdk1 UTSW 5 141936098 missense probably damaging 0.96
R5672:Sdk1 UTSW 5 142188145 missense possibly damaging 0.94
R5768:Sdk1 UTSW 5 142143871 missense probably benign 0.00
R5781:Sdk1 UTSW 5 141936048 missense probably benign 0.00
R5846:Sdk1 UTSW 5 142114393 missense probably damaging 1.00
R5851:Sdk1 UTSW 5 141962669 missense probably benign 0.00
R6164:Sdk1 UTSW 5 142132069 missense probably damaging 1.00
R6235:Sdk1 UTSW 5 142034426 missense possibly damaging 0.85
R6364:Sdk1 UTSW 5 141962709 missense probably benign 0.00
R6453:Sdk1 UTSW 5 142096921 missense probably damaging 1.00
R6892:Sdk1 UTSW 5 142046298 missense probably benign 0.00
R6996:Sdk1 UTSW 5 142212014 missense probably benign 0.16
R7003:Sdk1 UTSW 5 142096734 missense probably benign 0.01
R7022:Sdk1 UTSW 5 142094657 intron probably null
R7027:Sdk1 UTSW 5 142096726 splice site probably null
R7098:Sdk1 UTSW 5 142096870 missense probably damaging 0.96
R7107:Sdk1 UTSW 5 142081716 missense probably damaging 0.99
R7203:Sdk1 UTSW 5 142046176 missense probably benign 0.08
R7313:Sdk1 UTSW 5 141937622 missense probably damaging 0.97
R7363:Sdk1 UTSW 5 142188142 missense probably benign 0.05
R7375:Sdk1 UTSW 5 141998843 missense probably benign 0.01
R7446:Sdk1 UTSW 5 142144976 missense probably damaging 1.00
R7527:Sdk1 UTSW 5 141792976 missense possibly damaging 0.61
R7598:Sdk1 UTSW 5 141609998 nonsense probably null
R7747:Sdk1 UTSW 5 142084491 missense probably damaging 1.00
R7810:Sdk1 UTSW 5 141937679 missense probably benign
X0017:Sdk1 UTSW 5 141998780 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTGCAGGTCGCAGGCTGAGAAG -3'
(R):5'- CATGAAAACGATGTCTCTGGGCCAC -3'

Sequencing Primer
(F):5'- CTGAGAAGGTGGGTCATGCTC -3'
(R):5'- acacttctcctcacccctac -3'
Posted On2013-04-16