Incidental Mutation 'R2071:Ptprn'
ID227105
Institutional Source Beutler Lab
Gene Symbol Ptprn
Ensembl Gene ENSMUSG00000026204
Gene Nameprotein tyrosine phosphatase, receptor type, N
SynonymsIA-2
MMRRC Submission 040076-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.473) question?
Stock #R2071 (G1)
Quality Score178
Status Not validated
Chromosome1
Chromosomal Location75247027-75264502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75255144 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 504 (G504C)
Ref Sequence ENSEMBL: ENSMUSP00000027404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027404] [ENSMUST00000185849] [ENSMUST00000186178] [ENSMUST00000189769]
Predicted Effect probably damaging
Transcript: ENSMUST00000027404
AA Change: G504C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027404
Gene: ENSMUSG00000026204
AA Change: G504C

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
RESP18 63 164 1.5e-51 SMART
low complexity region 174 201 N/A INTRINSIC
low complexity region 217 235 N/A INTRINSIC
low complexity region 360 368 N/A INTRINSIC
Pfam:Receptor_IA-2 471 559 7e-33 PFAM
transmembrane domain 579 601 N/A INTRINSIC
low complexity region 650 679 N/A INTRINSIC
PTPc 710 973 1.2e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185849
SMART Domains Protein: ENSMUSP00000140062
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
RESP18 1 62 5e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186178
SMART Domains Protein: ENSMUSP00000139925
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
RESP18 27 128 1.5e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187216
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188401
Predicted Effect probably benign
Transcript: ENSMUST00000189769
SMART Domains Protein: ENSMUSP00000140168
Gene: ENSMUSG00000026204

DomainStartEndE-ValueType
RESP18 56 157 1.5e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191154
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single catalytic domain, and thus represents a receptor-type PTP. This PTP was found to be an autoantigen that is reactive with insulin-dependent diabetes mellitus (IDDM) patient sera, and thus may be a potential target of autoimmunity in diabetes mellitus. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Dec 2010]
PHENOTYPE: Mice homozygous for a disruption in this gene on a NOD background display insulitis and increased susceptibility to autoimmune diabetes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chek2 T C 5: 110,841,246 probably benign Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kat14 T C 2: 144,389,216 L181P probably damaging Het
Kifc3 A T 8: 95,108,353 probably null Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Vmn2r103 A T 17: 19,793,794 I283L probably benign Het
Xpr1 T C 1: 155,290,280 T574A probably benign Het
Zfp408 A G 2: 91,646,018 F364L probably damaging Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Ptprn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01772:Ptprn APN 1 75252270 missense probably damaging 0.99
IGL01900:Ptprn APN 1 75252248 splice site probably benign
IGL02189:Ptprn APN 1 75258495 missense possibly damaging 0.73
IGL02282:Ptprn APN 1 75253156 missense probably damaging 1.00
IGL02452:Ptprn APN 1 75258169 missense probably benign 0.34
IGL02865:Ptprn APN 1 75262363 missense probably damaging 1.00
IGL02926:Ptprn APN 1 75247873 missense possibly damaging 0.95
IGL03062:Ptprn APN 1 75247873 missense possibly damaging 0.95
Delusion UTSW 1 75248166 missense probably damaging 1.00
H8562:Ptprn UTSW 1 75254620 missense possibly damaging 0.66
R0051:Ptprn UTSW 1 75252254 critical splice donor site probably null
R0107:Ptprn UTSW 1 75255712 missense probably damaging 0.99
R0801:Ptprn UTSW 1 75252265 missense probably damaging 1.00
R0865:Ptprn UTSW 1 75248138 splice site probably null
R1120:Ptprn UTSW 1 75258181 missense probably benign 0.00
R1534:Ptprn UTSW 1 75257943 critical splice donor site probably null
R1740:Ptprn UTSW 1 75262050 missense probably damaging 1.00
R1857:Ptprn UTSW 1 75247905 missense possibly damaging 0.64
R1927:Ptprn UTSW 1 75254122 missense probably benign 0.00
R1974:Ptprn UTSW 1 75254820 splice site probably null
R2223:Ptprn UTSW 1 75257937 unclassified probably benign
R3714:Ptprn UTSW 1 75252767 splice site probably null
R4617:Ptprn UTSW 1 75252287 missense possibly damaging 0.74
R4832:Ptprn UTSW 1 75258265 missense probably benign 0.37
R5503:Ptprn UTSW 1 75251875 missense probably damaging 1.00
R5926:Ptprn UTSW 1 75254598 missense probably damaging 1.00
R6217:Ptprn UTSW 1 75248166 missense probably damaging 1.00
R6419:Ptprn UTSW 1 75264037 missense probably benign 0.10
R6793:Ptprn UTSW 1 75258142 missense probably benign 0.38
R6964:Ptprn UTSW 1 75260649 missense possibly damaging 0.83
R7071:Ptprn UTSW 1 75260619 missense possibly damaging 0.82
R7680:Ptprn UTSW 1 75247893 missense probably benign 0.16
R7777:Ptprn UTSW 1 75252302 missense possibly damaging 0.54
R7883:Ptprn UTSW 1 75262363 missense probably damaging 1.00
R8233:Ptprn UTSW 1 75253152 missense probably damaging 1.00
R8243:Ptprn UTSW 1 75252535 missense probably damaging 0.99
R8941:Ptprn UTSW 1 75251763 missense probably damaging 1.00
X0017:Ptprn UTSW 1 75253265 missense probably benign 0.15
Z1088:Ptprn UTSW 1 75260620 missense possibly damaging 0.70
Z1176:Ptprn UTSW 1 75251818 missense probably damaging 0.99
Z1177:Ptprn UTSW 1 75258037 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCAGATTCAGGATGAGGCTAGC -3'
(R):5'- CCTATGGGATTGGGTTAGCC -3'

Sequencing Primer
(F):5'- TAGCAGCAGGCCTACGTGTG -3'
(R):5'- CGAAGGTCCTGAGTTCAAATCTCAG -3'
Posted On2014-09-17