Incidental Mutation 'R2071:Zfp408'
ID227110
Institutional Source Beutler Lab
Gene Symbol Zfp408
Ensembl Gene ENSMUSG00000075040
Gene Namezinc finger protein 408
SynonymsLOC381410
MMRRC Submission 040076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2071 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location91643669-91649791 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91646018 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 364 (F364L)
Ref Sequence ENSEMBL: ENSMUSP00000097301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090614] [ENSMUST00000099714] [ENSMUST00000111329] [ENSMUST00000111331] [ENSMUST00000111333] [ENSMUST00000145582]
Predicted Effect probably benign
Transcript: ENSMUST00000090614
SMART Domains Protein: ENSMUSP00000088105
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099714
AA Change: F364L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097301
Gene: ENSMUSG00000075040
AA Change: F364L

DomainStartEndE-ValueType
ZnF_C2H2 344 366 7.05e-1 SMART
ZnF_C2H2 372 394 1.67e-2 SMART
ZnF_C2H2 400 422 2.24e-3 SMART
ZnF_C2H2 428 450 8.6e-5 SMART
ZnF_C2H2 459 481 5.9e-3 SMART
ZnF_C2H2 487 509 4.87e-4 SMART
ZnF_C2H2 515 537 2.95e-3 SMART
ZnF_C2H2 542 564 2.2e-2 SMART
ZnF_C2H2 570 592 1.69e-3 SMART
ZnF_C2H2 598 620 3.89e-3 SMART
low complexity region 625 638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111329
SMART Domains Protein: ENSMUSP00000106961
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 42 52 N/A INTRINSIC
SEC14 64 215 5.08e-25 SMART
low complexity region 224 238 N/A INTRINSIC
RhoGAP 257 428 1.06e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111331
SMART Domains Protein: ENSMUSP00000106963
Gene: ENSMUSG00000027247

DomainStartEndE-ValueType
low complexity region 44 58 N/A INTRINSIC
low complexity region 82 92 N/A INTRINSIC
SEC14 104 255 5.08e-25 SMART
low complexity region 264 278 N/A INTRINSIC
RhoGAP 297 468 1.06e-61 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111333
AA Change: F264L

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000106965
Gene: ENSMUSG00000075040
AA Change: F264L

DomainStartEndE-ValueType
ZnF_C2H2 244 266 7.05e-1 SMART
ZnF_C2H2 272 294 1.67e-2 SMART
ZnF_C2H2 300 322 2.24e-3 SMART
ZnF_C2H2 328 350 8.6e-5 SMART
ZnF_C2H2 359 381 5.9e-3 SMART
ZnF_C2H2 387 409 4.87e-4 SMART
ZnF_C2H2 415 437 2.95e-3 SMART
ZnF_C2H2 442 464 2.2e-2 SMART
ZnF_C2H2 470 492 1.69e-3 SMART
ZnF_C2H2 498 520 3.89e-3 SMART
low complexity region 525 538 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117988
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127702
Predicted Effect probably benign
Transcript: ENSMUST00000145582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155045
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten tandem zinc fingers and an N-terminal SET domain, so it is likely a DNA binding protein that interacts with other proteins. In adults, the encoded protein is expressed most highly in retina. Consequently, defects in this gene have been associated with familial exudative vitreoretinopathy (FEVR) and retinitis pigmentosa (RP). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chek2 T C 5: 110,841,246 probably benign Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kat14 T C 2: 144,389,216 L181P probably damaging Het
Kifc3 A T 8: 95,108,353 probably null Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Ptprn C A 1: 75,255,144 G504C probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Vmn2r103 A T 17: 19,793,794 I283L probably benign Het
Xpr1 T C 1: 155,290,280 T574A probably benign Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Zfp408
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Zfp408 APN 2 91648006 splice site probably benign
IGL02374:Zfp408 APN 2 91645811 missense probably damaging 1.00
IGL03012:Zfp408 APN 2 91647808 missense probably benign
Innuendo UTSW 2 91646345 missense probably benign 0.06
Slander UTSW 2 91647849 splice site probably benign
R0467:Zfp408 UTSW 2 91645537 missense possibly damaging 0.86
R0981:Zfp408 UTSW 2 91645183 missense probably benign 0.38
R1579:Zfp408 UTSW 2 91646128 missense probably benign 0.05
R1673:Zfp408 UTSW 2 91646008 missense probably damaging 0.97
R1935:Zfp408 UTSW 2 91649748 start codon destroyed probably null 0.95
R2127:Zfp408 UTSW 2 91645174 missense probably damaging 0.98
R2141:Zfp408 UTSW 2 91647849 splice site probably benign
R3688:Zfp408 UTSW 2 91646432 missense probably benign 0.00
R4681:Zfp408 UTSW 2 91645786 missense probably damaging 1.00
R4782:Zfp408 UTSW 2 91645024 missense possibly damaging 0.88
R4939:Zfp408 UTSW 2 91645105 missense probably damaging 1.00
R5306:Zfp408 UTSW 2 91646345 missense probably benign 0.06
R5344:Zfp408 UTSW 2 91645243 missense probably benign 0.15
R6054:Zfp408 UTSW 2 91649291 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGTTTTGCCGCATTGCTC -3'
(R):5'- TAGATGTCCCCAGCAGTCAGTG -3'

Sequencing Primer
(F):5'- CCTGAGTGGACCACCTGATGTTC -3'
(R):5'- AGTCAGTGCCCGTCTATAGC -3'
Posted On2014-09-17