Incidental Mutation 'R2071:Kat14'
ID 227113
Institutional Source Beutler Lab
Gene Symbol Kat14
Ensembl Gene ENSMUSG00000027425
Gene Name lysine acetyltransferase 14
Synonyms D2Wsu131e, 2510008M08Rik, ATAC2, Csrp2bp, D2Ertd473e
MMRRC Submission 040076-MU
Accession Numbers

Genbank: NM_181417; MGI: 1917264

Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R2071 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 144368983-144407676 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 144389216 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 181 (L181P)
Ref Sequence ENSEMBL: ENSMUSP00000028911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028911] [ENSMUST00000147747]
AlphaFold Q8CID0
Predicted Effect probably damaging
Transcript: ENSMUST00000028911
AA Change: L181P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028911
Gene: ENSMUSG00000027425
AA Change: L181P

DomainStartEndE-ValueType
low complexity region 21 41 N/A INTRINSIC
low complexity region 310 334 N/A INTRINSIC
Pfam:Acetyltransf_10 640 748 7e-12 PFAM
Pfam:Acetyltransf_7 670 750 5.8e-12 PFAM
Pfam:Acetyltransf_1 675 749 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143318
Predicted Effect probably benign
Transcript: ENSMUST00000147747
SMART Domains Protein: ENSMUSP00000130785
Gene: ENSMUSG00000027425

DomainStartEndE-ValueType
low complexity region 99 123 N/A INTRINSIC
Pfam:Acetyltransf_10 428 537 6.3e-12 PFAM
Pfam:Acetyltransf_7 458 539 5.7e-12 PFAM
Pfam:Acetyltransf_1 464 538 3.1e-12 PFAM
Pfam:FR47 479 544 2.4e-7 PFAM
Predicted Effect silent
Transcript: ENSMUST00000156410
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSRP2 is a protein containing two LIM domains, which are double zinc finger motifs found in proteins of diverse function. CSRP2 and some related proteins are thought to act as protein adapters, bridging two or more proteins to form a larger protein complex. The protein encoded by this gene binds to one of the LIM domains of CSRP2 and contains an acetyltransferase domain. Although the encoded protein has been detected in the cytoplasm, it is predominantly a nuclear protein. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jun 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, decreased size, increased apoptosis, and disrupted cell cycling. Mice heterozygous for one targeted allele exhibit corneal opacity. [provided by MGI curators]
Allele List at MGI

All alleles(54) : Targeted, other(1) Gene trapped(53)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chek2 T C 5: 110,841,246 probably benign Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kifc3 A T 8: 95,108,353 probably null Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Ptprn C A 1: 75,255,144 G504C probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Vmn2r103 A T 17: 19,793,794 I283L probably benign Het
Xpr1 T C 1: 155,290,280 T574A probably benign Het
Zfp408 A G 2: 91,646,018 F364L probably damaging Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Kat14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Kat14 APN 2 144394255 missense probably benign 0.01
IGL01361:Kat14 APN 2 144406620 splice site probably null
IGL01958:Kat14 APN 2 144394365 missense probably damaging 1.00
IGL02499:Kat14 APN 2 144393831 missense probably benign 0.45
IGL02625:Kat14 APN 2 144402445 missense possibly damaging 0.79
IGL02814:Kat14 APN 2 144402463 missense probably benign
IGL02883:Kat14 APN 2 144393529 missense probably damaging 1.00
IGL03114:Kat14 APN 2 144375965 critical splice donor site probably null
A5278:Kat14 UTSW 2 144393307 nonsense probably null
R1446:Kat14 UTSW 2 144373718 missense probably damaging 1.00
R1517:Kat14 UTSW 2 144373791 missense probably benign 0.00
R1589:Kat14 UTSW 2 144394100 missense probably benign 0.06
R3911:Kat14 UTSW 2 144404062 missense probably damaging 1.00
R3951:Kat14 UTSW 2 144407329 utr 3 prime probably benign
R4167:Kat14 UTSW 2 144394110 missense probably damaging 1.00
R4624:Kat14 UTSW 2 144404220 intron probably benign
R4628:Kat14 UTSW 2 144404220 intron probably benign
R4629:Kat14 UTSW 2 144404220 intron probably benign
R4944:Kat14 UTSW 2 144375953 missense probably damaging 0.99
R5401:Kat14 UTSW 2 144389260 missense possibly damaging 0.77
R5429:Kat14 UTSW 2 144393323 missense probably benign 0.03
R7165:Kat14 UTSW 2 144393998 missense probably benign 0.03
R7453:Kat14 UTSW 2 144380734 missense possibly damaging 0.85
R7738:Kat14 UTSW 2 144394242 missense probably damaging 1.00
R9130:Kat14 UTSW 2 144373822 missense probably benign 0.30
R9260:Kat14 UTSW 2 144393521 missense probably benign 0.02
X0018:Kat14 UTSW 2 144373857 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TAAAGGCAGGCAGATCCCAC -3'
(R):5'- GTGAAACTGTCCTGCTCACAG -3'

Sequencing Primer
(F):5'- AGATCCCACCCCTGGCTC -3'
(R):5'- TGCTCACAGCCCCAGAG -3'
Posted On 2014-09-17