Incidental Mutation 'R2071:Cyr61'
ID227120
Institutional Source Beutler Lab
Gene Symbol Cyr61
Ensembl Gene ENSMUSG00000028195
Gene Namecysteine rich protein 61
SynonymsCCN1
MMRRC Submission 040076-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.377) question?
Stock #R2071 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145646976-145649981 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 145648673 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 161 (W161*)
Ref Sequence ENSEMBL: ENSMUSP00000029846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029846]
Predicted Effect probably null
Transcript: ENSMUST00000029846
AA Change: W161*
SMART Domains Protein: ENSMUSP00000029846
Gene: ENSMUSG00000028195
AA Change: W161*

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
IB 24 93 1.16e-24 SMART
VWC 100 163 9.94e-23 SMART
low complexity region 164 184 N/A INTRINSIC
TSP1 229 271 1.34e-5 SMART
CT 289 358 3.74e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197148
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The secreted protein encoded by this gene is growth factor-inducible and promotes the adhesion of endothelial cells. The encoded protein interacts with several integrins and with heparan sulfate proteoglycan. This protein also plays a role in cell proliferation, differentiation, angiogenesis, apoptosis, and extracellular matrix formation. [provided by RefSeq, Sep 2011]
PHENOTYPE: Targeted null mice die pre- or perinatally, and none survive beyond 24 hrs of birth. About 30% of embryos die by E10.5 from defects in chorioallantoic fusion, whereas 70% die from placental vascular defects, including impaired allantoic vessel bifurcation, and loss of large-vessel integrity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chek2 T C 5: 110,841,246 probably benign Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kat14 T C 2: 144,389,216 L181P probably damaging Het
Kifc3 A T 8: 95,108,353 probably null Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Ptprn C A 1: 75,255,144 G504C probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Vmn2r103 A T 17: 19,793,794 I283L probably benign Het
Xpr1 T C 1: 155,290,280 T574A probably benign Het
Zfp408 A G 2: 91,646,018 F364L probably damaging Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Cyr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Cyr61 APN 3 145648610 missense probably damaging 0.96
IGL02500:Cyr61 APN 3 145648700 missense probably damaging 1.00
IGL02963:Cyr61 APN 3 145647875 missense probably damaging 1.00
IGL03170:Cyr61 APN 3 145649759 missense probably benign 0.01
R0018:Cyr61 UTSW 3 145649431 missense probably damaging 0.99
R0846:Cyr61 UTSW 3 145647770 missense possibly damaging 0.94
R0964:Cyr61 UTSW 3 145647748 missense probably damaging 1.00
R1234:Cyr61 UTSW 3 145649839 start gained probably benign
R1968:Cyr61 UTSW 3 145648210 missense probably damaging 0.99
R1989:Cyr61 UTSW 3 145647743 missense probably benign 0.31
R5622:Cyr61 UTSW 3 145649320 missense probably damaging 1.00
R5639:Cyr61 UTSW 3 145648697 missense probably damaging 1.00
R5734:Cyr61 UTSW 3 145648268 missense probably damaging 1.00
R5792:Cyr61 UTSW 3 145648658 missense probably benign
R6129:Cyr61 UTSW 3 145649231 missense possibly damaging 0.85
R6689:Cyr61 UTSW 3 145647788 missense probably benign
R7131:Cyr61 UTSW 3 145648781 missense probably damaging 1.00
R7289:Cyr61 UTSW 3 145648673 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGACCAAGAAAGCATTTC -3'
(R):5'- AGCTCAGTCAGAAGGCAGAC -3'

Sequencing Primer
(F):5'- TCTGCACAGTGTCTTAAGGAC -3'
(R):5'- GGCAGACCCTGTGAATATAACTC -3'
Posted On2014-09-17