Incidental Mutation 'R2071:Kifc3'
ID 227139
Institutional Source Beutler Lab
Gene Symbol Kifc3
Ensembl Gene ENSMUSG00000031788
Gene Name kinesin family member C3
Synonyms
MMRRC Submission 040076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2071 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 95099828-95202812 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 95108353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034240] [ENSMUST00000034240] [ENSMUST00000169353] [ENSMUST00000169353] [ENSMUST00000169748] [ENSMUST00000169748] [ENSMUST00000212424] [ENSMUST00000212787] [ENSMUST00000213004] [ENSMUST00000213004]
AlphaFold O35231
Predicted Effect probably null
Transcript: ENSMUST00000034240
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably null
Transcript: ENSMUST00000034240
SMART Domains Protein: ENSMUSP00000034240
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
coiled coil region 100 360 N/A INTRINSIC
coiled coil region 393 430 N/A INTRINSIC
KISc 441 774 3.15e-158 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169353
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169353
SMART Domains Protein: ENSMUSP00000127427
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 33 223 N/A INTRINSIC
coiled coil region 256 293 N/A INTRINSIC
KISc 304 637 3.15e-158 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169748
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect probably null
Transcript: ENSMUST00000169748
SMART Domains Protein: ENSMUSP00000126784
Gene: ENSMUSG00000031788

DomainStartEndE-ValueType
coiled coil region 34 324 N/A INTRINSIC
coiled coil region 357 394 N/A INTRINSIC
KISc 405 728 3.11e-148 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211854
Predicted Effect probably benign
Transcript: ENSMUST00000212424
Predicted Effect probably benign
Transcript: ENSMUST00000212787
Predicted Effect probably null
Transcript: ENSMUST00000213004
Predicted Effect probably null
Transcript: ENSMUST00000213004
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-14 family of microtubule motors. Members of this family play a role in the formation, maintenance and remodeling of the bipolar mitotic spindle. The protein encoded by this gene has cytoplasmic functions in the interphase cells. It may also be involved in the final stages of cytokinesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and appear phenotypically indistinguishable from wild-type littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chek2 T C 5: 110,841,246 probably benign Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kat14 T C 2: 144,389,216 L181P probably damaging Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Ptprn C A 1: 75,255,144 G504C probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Vmn2r103 A T 17: 19,793,794 I283L probably benign Het
Xpr1 T C 1: 155,290,280 T574A probably benign Het
Zfp408 A G 2: 91,646,018 F364L probably damaging Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Kifc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00720:Kifc3 APN 8 95138016 missense probably damaging 1.00
IGL01904:Kifc3 APN 8 95137957 missense possibly damaging 0.81
IGL02019:Kifc3 APN 8 95107540 splice site probably benign
IGL02090:Kifc3 APN 8 95102480 missense probably damaging 1.00
IGL02355:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02362:Kifc3 APN 8 95109879 missense probably damaging 1.00
IGL02620:Kifc3 APN 8 95109954 missense probably damaging 0.98
IGL02720:Kifc3 APN 8 95108365 missense probably benign 0.00
IGL03030:Kifc3 APN 8 95102412 missense probably damaging 1.00
IGL03327:Kifc3 APN 8 95108432 missense probably damaging 1.00
IGL03390:Kifc3 APN 8 95108613 missense probably damaging 1.00
R0233:Kifc3 UTSW 8 95101472 splice site probably null
R0281:Kifc3 UTSW 8 95103460 missense probably damaging 1.00
R0302:Kifc3 UTSW 8 95103470 missense possibly damaging 0.50
R0619:Kifc3 UTSW 8 95102665 missense probably benign 0.13
R0731:Kifc3 UTSW 8 95105733 missense probably damaging 1.00
R1017:Kifc3 UTSW 8 95105785 missense probably damaging 0.99
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1147:Kifc3 UTSW 8 95137918 missense probably damaging 1.00
R1257:Kifc3 UTSW 8 95105772 missense probably damaging 0.98
R1472:Kifc3 UTSW 8 95137913 critical splice donor site probably null
R1480:Kifc3 UTSW 8 95109887 missense probably damaging 1.00
R1553:Kifc3 UTSW 8 95106542 missense possibly damaging 0.67
R2115:Kifc3 UTSW 8 95108713 missense probably damaging 1.00
R3703:Kifc3 UTSW 8 95104028 splice site probably benign
R3704:Kifc3 UTSW 8 95104028 splice site probably benign
R3705:Kifc3 UTSW 8 95104028 splice site probably benign
R4223:Kifc3 UTSW 8 95109982 missense probably damaging 0.96
R4463:Kifc3 UTSW 8 95102116 missense probably damaging 1.00
R4508:Kifc3 UTSW 8 95107420 splice site probably null
R4980:Kifc3 UTSW 8 95126549 missense probably benign
R5032:Kifc3 UTSW 8 95102726 missense probably damaging 1.00
R5068:Kifc3 UTSW 8 95110216 missense possibly damaging 0.54
R5421:Kifc3 UTSW 8 95109845 missense probably damaging 0.99
R5556:Kifc3 UTSW 8 95108459 nonsense probably null
R6845:Kifc3 UTSW 8 95108679 missense probably benign 0.28
R7136:Kifc3 UTSW 8 95103449 missense probably benign 0.10
R7196:Kifc3 UTSW 8 95106611 missense probably benign 0.02
R7404:Kifc3 UTSW 8 95103464 missense probably benign 0.02
R7441:Kifc3 UTSW 8 95137987 missense probably benign 0.00
R7784:Kifc3 UTSW 8 95110692 critical splice donor site probably null
R7861:Kifc3 UTSW 8 95107537 critical splice acceptor site probably null
R8440:Kifc3 UTSW 8 95109794 missense possibly damaging 0.89
R8754:Kifc3 UTSW 8 95102396 missense probably damaging 1.00
R8983:Kifc3 UTSW 8 95106476 missense probably damaging 1.00
R9035:Kifc3 UTSW 8 95126567 missense possibly damaging 0.52
R9149:Kifc3 UTSW 8 95126689 missense probably benign
R9464:Kifc3 UTSW 8 95103994 missense possibly damaging 0.61
X0023:Kifc3 UTSW 8 95109298 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGATGCCTACAAAATGAGC -3'
(R):5'- AGTACACGAGAACCTGGCAG -3'

Sequencing Primer
(F):5'- CATTTGCCTATCAGGTGAGAAGCC -3'
(R):5'- GCAGGTGAGCCGGAAGC -3'
Posted On 2014-09-17