Incidental Mutation 'R2071:Trp53'
ID227153
Institutional Source Beutler Lab
Gene Symbol Trp53
Ensembl Gene ENSMUSG00000059552
Gene Nametransformation related protein 53
Synonymsp44, p53
MMRRC Submission 040076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2071 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69580359-69591873 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69589632 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 278 (D278G)
Ref Sequence ENSEMBL: ENSMUSP00000104298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005371] [ENSMUST00000108657] [ENSMUST00000108658] [ENSMUST00000171247]
Predicted Effect probably damaging
Transcript: ENSMUST00000005371
AA Change: D275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005371
Gene: ENSMUSG00000059552
AA Change: D275G

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 1.3e-10 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 8.2e-108 PFAM
Pfam:P53_tetramer 312 353 4.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108657
AA Change: D275G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104297
Gene: ENSMUSG00000059552
AA Change: D275G

DomainStartEndE-ValueType
Pfam:P53_TAD 5 28 6.1e-11 PFAM
low complexity region 69 86 N/A INTRINSIC
Pfam:P53 89 283 4.7e-108 PFAM
Pfam:P53_tetramer 312 353 1.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108658
AA Change: D278G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104298
Gene: ENSMUSG00000059552
AA Change: D278G

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.4e-12 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 9.8e-113 PFAM
Pfam:P53_tetramer 316 355 5.8e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130540
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147512
Predicted Effect probably damaging
Transcript: ENSMUST00000171247
AA Change: D278G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127130
Gene: ENSMUSG00000059552
AA Change: D278G

DomainStartEndE-ValueType
Pfam:P53_TAD 8 31 1.2e-10 PFAM
low complexity region 72 89 N/A INTRINSIC
Pfam:P53 92 286 7.9e-108 PFAM
Pfam:P53_tetramer 315 356 4.3e-21 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes tumor protein p53, which responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. p53 protein is expressed at low level in normal cells and at a high level in a variety of transformed cell lines, where it's believed to contribute to transformation and malignancy. p53 is a DNA-binding protein containing transcription activation, DNA-binding, and oligomerization domains. It is postulated to bind to a p53-binding site and activate expression of downstream genes that inhibit growth and/or invasion, and thus function as a tumor suppressor. Mice deficient for this gene are developmentally normal but are susceptible to spontaneous tumors. Evidence to date shows that this gene contains one promoter, in contrast to alternative promoters of the human gene, and transcribes a few of splice variants which encode different isoforms, although the biological validity or the full-length nature of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this locus affect cell-cycle regulation and apoptosis. Null homozygotes show high, early-onset tumor incidence; some have persistent hyaloid vasculature and cataracts. Truncated or temperature-sensitive alleles cause early aging phenotypes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chek2 T C 5: 110,841,246 probably benign Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kat14 T C 2: 144,389,216 L181P probably damaging Het
Kifc3 A T 8: 95,108,353 probably null Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Ptprn C A 1: 75,255,144 G504C probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Vmn2r103 A T 17: 19,793,794 I283L probably benign Het
Xpr1 T C 1: 155,290,280 T574A probably benign Het
Zfp408 A G 2: 91,646,018 F364L probably damaging Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Trp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Trp53 APN 11 69588523 missense probably damaging 1.00
IGL02105:Trp53 APN 11 69588503 missense probably damaging 1.00
R0112:Trp53 UTSW 11 69588679 missense probably damaging 1.00
R0196:Trp53 UTSW 11 69588680 missense probably damaging 1.00
R0512:Trp53 UTSW 11 69588683 missense probably damaging 1.00
R1976:Trp53 UTSW 11 69588497 missense probably damaging 1.00
R2070:Trp53 UTSW 11 69589632 missense probably damaging 1.00
R2988:Trp53 UTSW 11 69588506 missense probably damaging 1.00
R4698:Trp53 UTSW 11 69588422 nonsense probably null
R4776:Trp53 UTSW 11 69586921 missense probably benign 0.05
R4838:Trp53 UTSW 11 69587630 missense probably damaging 1.00
R5269:Trp53 UTSW 11 69589205 missense probably damaging 1.00
R5360:Trp53 UTSW 11 69588740 critical splice donor site probably null
R5399:Trp53 UTSW 11 69588546 missense probably benign 0.19
R5420:Trp53 UTSW 11 69588320 intron probably benign
R5982:Trp53 UTSW 11 69587418 missense probably benign 0.06
R6051:Trp53 UTSW 11 69589608 missense possibly damaging 0.93
R6305:Trp53 UTSW 11 69588707 missense probably damaging 1.00
R6457:Trp53 UTSW 11 69589614 missense probably damaging 1.00
R6947:Trp53 UTSW 11 69588481 missense possibly damaging 0.93
R7278:Trp53 UTSW 11 69591255 missense probably benign 0.00
R7339:Trp53 UTSW 11 69589189 missense probably damaging 1.00
R7418:Trp53 UTSW 11 69588388 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTGGACCTTTGGCTGC -3'
(R):5'- TCCAGCCTTGGTACCTTGAG -3'

Sequencing Primer
(F):5'- CCTTTGGCTGCAGATATGACAAG -3'
(R):5'- GGGTGAAATACTCTCCATCAAGTG -3'
Posted On2014-09-17