Incidental Mutation 'R2071:Vmn2r103'
ID227180
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Namevomeronasal 2, receptor 103
SynonymsEG627636
MMRRC Submission 040076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R2071 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location19773363-19812536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19793794 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 283 (I283L)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
Predicted Effect probably benign
Transcript: ENSMUST00000172203
AA Change: I283L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: I283L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik T A 1: 57,383,315 H283Q probably damaging Het
2810021J22Rik A G 11: 58,876,769 K31E probably damaging Het
Abcc10 G C 17: 46,303,565 N1477K probably benign Het
Adam33 T C 2: 131,055,346 T310A probably benign Het
Afm A G 5: 90,523,735 D92G probably benign Het
Arg1 C T 10: 24,922,663 A30T probably benign Het
Ash1l C G 3: 88,966,203 P98A probably damaging Het
Atad5 A T 11: 80,098,052 probably null Het
Atg2a T C 19: 6,257,458 V1474A probably benign Het
Atp12a A G 14: 56,366,009 K24E probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt4 A T 5: 123,511,370 H266L probably benign Het
Bora T C 14: 99,062,278 S229P probably damaging Het
C87414 T G 5: 93,636,516 Q363P probably damaging Het
Cdsn A T 17: 35,554,694 D40V probably damaging Het
Cep295 T C 9: 15,341,564 R323G probably damaging Het
Chek2 T C 5: 110,841,246 probably benign Het
Chga A T 12: 102,562,863 K366N probably damaging Het
Chrm5 T C 2: 112,479,227 K515E probably null Het
Cmtr1 A G 17: 29,694,783 probably null Het
Cyr61 C T 3: 145,648,673 W161* probably null Het
Dsg3 T C 18: 20,536,825 L632S probably damaging Het
Fam129a T C 1: 151,636,430 F28L probably damaging Het
Fzd3 A G 14: 65,235,563 F252S probably damaging Het
Gas2l2 T C 11: 83,421,949 K846E probably benign Het
Gm21761 A T 13: 119,912,300 D151E probably benign Het
Gm8300 T A 12: 87,517,052 F52L probably benign Het
Gpatch11 T C 17: 78,841,085 probably null Het
Gucy2g T A 19: 55,222,340 Y661F possibly damaging Het
Hhip A G 8: 80,057,302 F72L probably benign Het
Kat14 T C 2: 144,389,216 L181P probably damaging Het
Kifc3 A T 8: 95,108,353 probably null Het
Kntc1 G T 5: 123,794,277 probably null Het
Man2b1 G T 8: 85,085,384 V156L possibly damaging Het
Mast1 T C 8: 84,921,194 D517G probably damaging Het
Mc1r T C 8: 123,408,369 L287P possibly damaging Het
Mctp1 A T 13: 76,759,724 E238V probably damaging Het
Mmp12 T A 9: 7,349,725 I52N probably damaging Het
Morc1 C T 16: 48,592,611 T705I probably benign Het
Mrpl24 T C 3: 87,923,067 probably null Het
Nap1l1 C T 10: 111,492,900 T230I possibly damaging Het
Nmral1 T A 16: 4,716,347 I77F probably damaging Het
Nudt13 T A 14: 20,303,977 D36E probably damaging Het
Oxsm A G 14: 16,241,983 L262P probably benign Het
Pde10a A T 17: 8,961,995 I754F probably benign Het
Pdzph1 T C 17: 58,974,097 R397G probably benign Het
Polr1a T A 6: 71,976,074 V567E possibly damaging Het
Pou3f2 A G 4: 22,488,076 V19A probably benign Het
Pth1r A G 9: 110,727,013 I264T probably benign Het
Ptprn C A 1: 75,255,144 G504C probably damaging Het
Rbak A G 5: 143,176,584 L8P probably damaging Het
Rev3l T A 10: 39,824,353 D1615E probably benign Het
Rhob A G 12: 8,499,232 M134T probably benign Het
Slc10a4 T C 5: 73,007,497 L144P probably damaging Het
Slc45a3 T C 1: 131,977,632 L131P probably damaging Het
Slf1 T A 13: 77,104,624 E259D probably benign Het
Slitrk5 A G 14: 111,680,189 Y415C probably damaging Het
Sohlh2 A G 3: 55,207,622 I343V probably benign Het
Sorl1 T C 9: 41,979,457 D1922G possibly damaging Het
Spats2l T A 1: 57,940,464 I243N possibly damaging Het
Specc1 A C 11: 62,117,875 K152N probably damaging Het
Sv2a G A 3: 96,193,875 A730T possibly damaging Het
Tars2 C A 3: 95,747,638 G113C probably damaging Het
Tep1 T C 14: 50,854,282 K601E probably benign Het
Tmem8 T C 17: 26,122,043 Y176H probably damaging Het
Trp53 A G 11: 69,589,632 D278G probably damaging Het
Ttc39d G A 17: 80,216,601 G230R probably damaging Het
Tubb2b T A 13: 34,128,261 Y183F probably damaging Het
Ubxn7 T A 16: 32,372,469 C160S possibly damaging Het
Vcp A G 4: 42,995,894 probably null Het
Vmn1r201 T C 13: 22,474,825 F70L probably benign Het
Vmn1r49 C T 6: 90,072,202 V273I probably benign Het
Xpr1 T C 1: 155,290,280 T574A probably benign Het
Zfp408 A G 2: 91,646,018 F364L probably damaging Het
Zfyve26 A G 12: 79,287,446 L266P possibly damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 19793102 missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 19794965 missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 19792997 missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 19792967 missense probably benign
IGL01404:Vmn2r103 APN 17 19812434 missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 19794068 missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 19799208 missense probably benign
IGL02251:Vmn2r103 APN 17 19793969 missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19773369 missense probably benign
IGL02555:Vmn2r103 APN 17 19811611 missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 19794127 missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 19793956 missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 19812248 missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19773520 missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 19811979 missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 19811641 missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 19792859 missense probably benign 0.06
R0375:Vmn2r103 UTSW 17 19793464 missense probably benign 0.12
R0755:Vmn2r103 UTSW 17 19773568 missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 19793927 missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 19794247 missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 19792968 missense probably benign
R1488:Vmn2r103 UTSW 17 19793660 missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19773400 missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 19794234 missense probably benign
R1928:Vmn2r103 UTSW 17 19811767 missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 19812300 missense probably benign 0.02
R2219:Vmn2r103 UTSW 17 19793647 missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19773531 missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 19793600 missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 19812149 missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 19794233 missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 19793696 missense probably benign 0.04
R4660:Vmn2r103 UTSW 17 19811815 missense probably damaging 1.00
R4801:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 19795076 missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 19811769 missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 19793034 missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 19812171 missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 19793642 missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 19792989 missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 19794939 missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 19812453 missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 19794216 nonsense probably null
R6114:Vmn2r103 UTSW 17 19812325 missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 19812144 missense probably benign
R6292:Vmn2r103 UTSW 17 19793604 missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 19794082 missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 19811904 missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 19811977 missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19773511 missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 19793477 missense probably benign 0.00
Z1088:Vmn2r103 UTSW 17 19795047 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CTCCCTGATGACCACAAAGG -3'
(R):5'- CAAATGCCACAGCTTAGGAAG -3'

Sequencing Primer
(F):5'- GCCACATGGACTTCACAT -3'
(R):5'- GCCACAGCTTAGGAAGATAAATATC -3'
Posted On2014-09-17