Mutagenetix > Incidental Mutations

Incidental Mutation 'R2072:Fpgt'

227204

Institutional Source

Beutler Lab

Gene Symbol

Fpgt

Ensembl Gene

ENSMUSG00000053870

Gene Name

fucose-1-phosphate guanylyltransferase

Synonyms

1700016E03Rik

MMRRC Submission

040077-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R2072 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

155084918-155093403 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 155087874 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 172 (Y172C)

Ref Sequence

ENSEMBL: ENSMUSP00000068939 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066568]

AlphaFold

G5E8F4

Predicted Effect

probably damaging
Transcript: ENSMUST00000066568
AA Change: Y172C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000068939
Gene: ENSMUSG00000053870
AA Change: Y172C

Domain	Start	End	E-Value	Type
low complexity region	82	92	N/A	INTRINSIC
Pfam:Fucokinase	106	524	1.8e-147	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000082831

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192247

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000192959

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193071

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194095

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195505

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-fucose is a key sugar in glycoproteins and other complex carbohydrates since it may be involved in many of the functional roles of these macromolecules, such as in cell-cell recognition. The fucosyl donor for these fucosylated oligosaccharides is GDP-beta-L-fucose. There are two alternate pathways for the biosynthesis of GDP-fucose; the major pathway converts GDP-alpha-D-mannose to GDP-beta-L-fucose. The protein encoded by this gene participates in an alternate pathway that is present in certain mammalian tissues, such as liver and kidney, and appears to function as a salvage pathway to reutilize L-fucose arising from the turnover of glycoproteins and glycolipids. This pathway involves the phosphorylation of L-fucose to form beta-L-fucose-1-phosphate, and then condensation of the beta-L-fucose-1-phosphate with GTP by fucose-1-phosphate guanylyltransferase to form GDP-beta-L-fucose. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream TNNI3 interacting kinase (TNNI3K) gene. [provided by RefSeq, Dec 2010]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	C	5: 63,898,737	R272P	possibly damaging	Het
9130011E15Rik	A	T	19: 45,965,381	I188K	probably damaging	Het
Ablim3	A	T	18: 61,857,088	D83E	possibly damaging	Het
Aco1	G	A	4: 40,183,605	G508S	probably damaging	Het
Adamts13	C	A	2: 27,005,425	T1176N	probably benign	Het
Adgre5	T	C	8: 83,727,804	T357A	probably benign	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Ankrd33	T	C	15: 101,119,636	V310A	probably benign	Het
Bnipl	C	T	3: 95,244,211	G232E	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Cacna1s	G	A	1: 136,079,504	V173I	probably benign	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chrdl1	T	C	X: 143,303,418	I231V	probably benign	Het
Ciita	C	T	16: 10,518,353	T958I	probably benign	Het
Cnot1	G	T	8: 95,739,833	T1592K	possibly damaging	Het
Dcaf15	T	C	8: 84,101,741	D240G	probably damaging	Het
Ddx58	A	T	4: 40,224,069		probably null	Het
Dlgap1	C	T	17: 70,662,770	R524C	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dsg1c	A	G	18: 20,275,252	M453V	probably benign	Het
Ednrb	G	T	14: 103,817,099	N432K	probably benign	Het
Fcgbp	G	A	7: 28,120,389	G2514S	probably damaging	Het
Fez1	A	G	9: 36,867,945	K306R	probably benign	Het
Fmo4	A	G	1: 162,809,887	V12A	probably benign	Het
Fsip2	T	A	2: 83,008,815	F6976I	possibly damaging	Het
Galnt12	C	T	4: 47,108,477	R205*	probably null	Het
Grik5	A	T	7: 25,015,313	M752K	possibly damaging	Het
Herc2	A	G	7: 56,226,964	N4516S	probably damaging	Het
Ifrd2	A	T	9: 107,592,545	D439V	probably damaging	Het
Igsf3	A	G	3: 101,439,515	T609A	probably benign	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
Lgi2	A	G	5: 52,538,505	S371P	probably damaging	Het
March3	A	T	18: 56,811,853	V56E	possibly damaging	Het
Mib2	T	C	4: 155,659,701	D168G	probably damaging	Het
Nhs	T	A	X: 161,842,721	H544L	probably damaging	Het
Nlrp2	A	G	7: 5,325,006	S683P	probably damaging	Het
Olfr1260	C	A	2: 89,978,213	T145K	probably benign	Het
Olfr1454	A	T	19: 13,063,680	M90L	probably benign	Het
Olfr527	T	C	7: 140,336,653	S264P	possibly damaging	Het
Onecut3	T	G	10: 80,495,014	L3V	unknown	Het
Otogl	C	T	10: 107,781,043	C1791Y	probably damaging	Het
Paip1	T	C	13: 119,430,262	V128A	possibly damaging	Het
Pcnx2	A	T	8: 125,761,742	C1688S	possibly damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plxnb2	G	T	15: 89,158,451	R1545S	probably damaging	Het
Ppp4c	T	C	7: 126,787,348		probably null	Het
Prune1	C	T	3: 95,255,408	R318Q	probably benign	Het
Psg27	T	C	7: 18,560,417	D355G	probably damaging	Het
Psg27	A	G	7: 18,565,009	L129P	probably benign	Het
Psmc6	A	G	14: 45,329,866	K7E	possibly damaging	Het
Reln	A	T	5: 21,919,177	V2777E	probably damaging	Het
Scn11a	G	T	9: 119,811,208	A207E	possibly damaging	Het
Slc5a5	C	T	8: 70,892,439	G75R	possibly damaging	Het
Smarcd2	A	T	11: 106,265,307	L42*	probably null	Het
Smg1	T	C	7: 118,163,166		probably benign	Het
Smurf2	T	A	11: 106,841,769	Q335L	probably benign	Het
Sspo	A	T	6: 48,473,517	H2580L	probably benign	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Syt1	A	G	10: 108,583,972	I276T	probably damaging	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Taar9	A	T	10: 24,108,979	C186S	probably damaging	Het
Tnrc6b	C	T	15: 80,882,965	P977L	possibly damaging	Het
Trp53bp2	A	G	1: 182,458,867	T1091A	probably benign	Het
Ttn	G	T	2: 76,937,776	T2947N	probably damaging	Het
Ube2q1	T	C	3: 89,779,571		probably null	Het
Ube3c	A	G	5: 29,635,640	E671G	probably benign	Het
Upf3a	A	G	8: 13,785,850	K56R	possibly damaging	Het
Vmn2r15	A	T	5: 109,286,753	M695K	possibly damaging	Het
Vmn2r3	A	T	3: 64,275,072	M402K	possibly damaging	Het
Zfp354b	T	A	11: 50,922,452	R549*	probably null	Het
Zfp37	A	T	4: 62,191,708	M411K	probably damaging	Het
Zfp747	T	A	7: 127,373,970	T343S	possibly damaging	Het
Zfp853	T	A	5: 143,289,382	Q161L	unknown	Het

Other mutations in Fpgt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01021:Fpgt	APN	3	155091492	missense	possibly damaging	0.92
IGL01412:Fpgt	APN	3	155086722	missense	probably benign	0.06
IGL01860:Fpgt	APN	3	155086846	missense	probably benign	0.38
IGL01977:Fpgt	APN	3	155088018	missense	probably damaging	0.99
IGL02136:Fpgt	APN	3	155093352	missense	probably benign
IGL02331:Fpgt	APN	3	155087862	missense	possibly damaging	0.90
IGL03106:Fpgt	APN	3	155087122	missense	probably damaging	1.00
PIT4431001:Fpgt	UTSW	3	155086785	missense	possibly damaging	0.95
R4287:Fpgt	UTSW	3	155091360	unclassified	probably benign
R4607:Fpgt	UTSW	3	155086696	nonsense	probably null
R4608:Fpgt	UTSW	3	155086696	nonsense	probably null
R4873:Fpgt	UTSW	3	155087913	missense	probably damaging	1.00
R4875:Fpgt	UTSW	3	155087913	missense	probably damaging	1.00
R5973:Fpgt	UTSW	3	155087403	missense	probably damaging	1.00
R7134:Fpgt	UTSW	3	155091483	missense	probably damaging	1.00
R7300:Fpgt	UTSW	3	155086975	missense	probably damaging	0.98
R7505:Fpgt	UTSW	3	155086776	missense	possibly damaging	0.92
R7521:Fpgt	UTSW	3	155087128	missense	possibly damaging	0.96
R7690:Fpgt	UTSW	3	155087830	missense	probably damaging	1.00
R7736:Fpgt	UTSW	3	155087110	missense	probably benign	0.34
R7815:Fpgt	UTSW	3	155086652	missense	probably benign	0.00
R8061:Fpgt	UTSW	3	155087266	missense	probably benign	0.00
R9017:Fpgt	UTSW	3	155087266	missense	probably benign	0.01
R9298:Fpgt	UTSW	3	155087058	nonsense	probably null
R9375:Fpgt	UTSW	3	155087297	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- AGACAAGTTCTGTTGACCAAAGC -3'
(R):5'- TTCCCAATGCGAGTGCTTTAGG -3'

Sequencing Primer
(F):5'- CAAAGCTTCGTTGTCTATGCACAG -3'
(R):5'- GTGCTTTAGGAAAGATCTTCACAGCC -3'

Posted On

2014-09-17