Incidental Mutation 'R2072:Grik5'
ID 227223
Institutional Source Beutler Lab
Gene Symbol Grik5
Ensembl Gene ENSMUSG00000003378
Gene Name glutamate receptor, ionotropic, kainate 5 (gamma 2)
Synonyms GluRgamma2, KA2
MMRRC Submission 040077-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.295) question?
Stock # R2072 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 25009849-25072346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25015313 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 752 (M752K)
Ref Sequence ENSEMBL: ENSMUSP00000003468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000205328] [ENSMUST00000206134]
AlphaFold Q61626
Predicted Effect possibly damaging
Transcript: ENSMUST00000003468
AA Change: M752K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: M752K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 40 381 3.4e-64 PFAM
PBPe 416 785 3.7e-122 SMART
Lig_chan-Glu_bd 426 490 1.65e-29 SMART
transmembrane domain 804 823 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 893 921 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205328
Predicted Effect probably benign
Transcript: ENSMUST00000206134
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 R272P possibly damaging Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Ablim3 A T 18: 61,857,088 D83E possibly damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Adamts13 C A 2: 27,005,425 T1176N probably benign Het
Adgre5 T C 8: 83,727,804 T357A probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 V310A probably benign Het
Bnipl C T 3: 95,244,211 G232E probably damaging Het
Btbd17 A T 11: 114,791,952 probably null Het
Cacna1s G A 1: 136,079,504 V173I probably benign Het
Ccdc122 T C 14: 77,068,951 probably null Het
Ces1a T A 8: 93,048,075 N12Y probably benign Het
Chrdl1 T C X: 143,303,418 I231V probably benign Het
Ciita C T 16: 10,518,353 T958I probably benign Het
Cnot1 G T 8: 95,739,833 T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 D240G probably damaging Het
Ddx58 A T 4: 40,224,069 probably null Het
Dlgap1 C T 17: 70,662,770 R524C probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dsg1c A G 18: 20,275,252 M453V probably benign Het
Ednrb G T 14: 103,817,099 N432K probably benign Het
Fcgbp G A 7: 28,120,389 G2514S probably damaging Het
Fez1 A G 9: 36,867,945 K306R probably benign Het
Fmo4 A G 1: 162,809,887 V12A probably benign Het
Fpgt T C 3: 155,087,874 Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 R205* probably null Het
Herc2 A G 7: 56,226,964 N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 D439V probably damaging Het
Igsf3 A G 3: 101,439,515 T609A probably benign Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
Lgi2 A G 5: 52,538,505 S371P probably damaging Het
March3 A T 18: 56,811,853 V56E possibly damaging Het
Mib2 T C 4: 155,659,701 D168G probably damaging Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 S683P probably damaging Het
Olfr1260 C A 2: 89,978,213 T145K probably benign Het
Olfr1454 A T 19: 13,063,680 M90L probably benign Het
Olfr527 T C 7: 140,336,653 S264P possibly damaging Het
Onecut3 T G 10: 80,495,014 L3V unknown Het
Otogl C T 10: 107,781,043 C1791Y probably damaging Het
Paip1 T C 13: 119,430,262 V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 probably null Het
Prune1 C T 3: 95,255,408 R318Q probably benign Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Psg27 A G 7: 18,565,009 L129P probably benign Het
Psmc6 A G 14: 45,329,866 K7E possibly damaging Het
Reln A T 5: 21,919,177 V2777E probably damaging Het
Scn11a G T 9: 119,811,208 A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 L42* probably null Het
Smg1 T C 7: 118,163,166 probably benign Het
Smurf2 T A 11: 106,841,769 Q335L probably benign Het
Sspo A T 6: 48,473,517 H2580L probably benign Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syt1 A G 10: 108,583,972 I276T probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar9 A T 10: 24,108,979 C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 T1091A probably benign Het
Ttn G T 2: 76,937,776 T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 probably null Het
Ube3c A G 5: 29,635,640 E671G probably benign Het
Upf3a A G 8: 13,785,850 K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 R549* probably null Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp747 T A 7: 127,373,970 T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 Q161L unknown Het
Other mutations in Grik5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Grik5 APN 7 25065393 missense probably damaging 1.00
IGL00974:Grik5 APN 7 25013885 missense probably damaging 1.00
IGL01941:Grik5 APN 7 25065182 missense probably damaging 1.00
IGL02642:Grik5 APN 7 25058983 missense possibly damaging 0.51
IGL03177:Grik5 APN 7 25015454 missense probably damaging 1.00
IGL03402:Grik5 APN 7 25015469 missense probably damaging 1.00
Griffin UTSW 7 25059077 missense possibly damaging 0.78
G1citation:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
PIT4453001:Grik5 UTSW 7 25010694 missense probably damaging 0.99
R0077:Grik5 UTSW 7 25023380 missense probably damaging 1.00
R0412:Grik5 UTSW 7 25013674 missense possibly damaging 0.59
R0427:Grik5 UTSW 7 25058498 missense probably benign 0.34
R1191:Grik5 UTSW 7 25058325 nonsense probably null
R1830:Grik5 UTSW 7 25046301 missense possibly damaging 0.94
R2369:Grik5 UTSW 7 25058537 missense probably damaging 1.00
R3410:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3411:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3615:Grik5 UTSW 7 25022571 missense probably benign 0.37
R3616:Grik5 UTSW 7 25022571 missense probably benign 0.37
R4600:Grik5 UTSW 7 25068064 missense probably damaging 0.99
R4658:Grik5 UTSW 7 25060727 splice site probably benign
R4735:Grik5 UTSW 7 25058288 missense probably damaging 1.00
R4810:Grik5 UTSW 7 25015497 missense probably damaging 0.98
R5113:Grik5 UTSW 7 25015527 missense probably damaging 1.00
R5120:Grik5 UTSW 7 25010640 missense probably damaging 1.00
R5132:Grik5 UTSW 7 25065204 missense probably benign 0.02
R5173:Grik5 UTSW 7 25062894 missense possibly damaging 0.76
R5186:Grik5 UTSW 7 25015819 missense probably damaging 1.00
R5239:Grik5 UTSW 7 25065470 missense probably damaging 1.00
R5935:Grik5 UTSW 7 25059077 missense possibly damaging 0.78
R6335:Grik5 UTSW 7 25013594 missense probably benign
R6609:Grik5 UTSW 7 25015526 nonsense probably null
R6760:Grik5 UTSW 7 25058939 critical splice donor site probably null
R6820:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6821:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6822:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6824:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R7173:Grik5 UTSW 7 25068162 missense probably damaging 1.00
R7230:Grik5 UTSW 7 25023070 missense probably damaging 1.00
R7555:Grik5 UTSW 7 25060597 missense probably benign
R7560:Grik5 UTSW 7 25058526 missense probably damaging 0.99
R7571:Grik5 UTSW 7 25013885 missense possibly damaging 0.87
R8228:Grik5 UTSW 7 25010508 missense probably damaging 1.00
R8228:Grik5 UTSW 7 25046310 missense possibly damaging 0.93
R8681:Grik5 UTSW 7 25010472 missense probably benign 0.06
R8879:Grik5 UTSW 7 25023064 missense possibly damaging 0.95
R8933:Grik5 UTSW 7 25023318 missense probably benign 0.11
R9129:Grik5 UTSW 7 25068004 splice site probably benign
R9130:Grik5 UTSW 7 25068004 splice site probably benign
R9154:Grik5 UTSW 7 25058978 missense probably damaging 1.00
R9317:Grik5 UTSW 7 25046235 missense probably damaging 0.99
R9355:Grik5 UTSW 7 25068172 missense possibly damaging 0.82
R9406:Grik5 UTSW 7 25058544 missense probably benign 0.00
X0017:Grik5 UTSW 7 25060588 missense probably damaging 1.00
Z1176:Grik5 UTSW 7 25013804 missense probably damaging 0.98
Z1177:Grik5 UTSW 7 25015825 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCAGAATTCCCTTAGCACC -3'
(R):5'- CTACATGCAATCGAAGCAGC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- CCCAGCGTGTTTGTCAAGAG -3'
Posted On 2014-09-17