Mutagenetix > Incidental Mutation

Incidental Mutation 'R2072:Pcnx2'

227240

Institutional Source

Beutler Lab

Gene Symbol

Pcnx2

Ensembl Gene

ENSMUSG00000060212

Gene Name

pecanex homolog 2

Synonyms

Pcnxl2, E330039K12Rik

MMRRC Submission

040077-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2072 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125751508-125898317 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 125761742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1688 (C1688S)

Ref Sequence

ENSEMBL: ENSMUSP00000042294 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047239]

AlphaFold

Q5DU28

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047239
AA Change: C1688S

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000042294
Gene: ENSMUSG00000060212
AA Change: C1688S

Domain	Start	End	E-Value	Type
transmembrane domain	36	53	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	94	104	N/A	INTRINSIC
low complexity region	391	415	N/A	INTRINSIC
low complexity region	457	476	N/A	INTRINSIC
low complexity region	727	742	N/A	INTRINSIC
low complexity region	806	817	N/A	INTRINSIC
transmembrane domain	823	842	N/A	INTRINSIC
transmembrane domain	849	866	N/A	INTRINSIC
transmembrane domain	881	902	N/A	INTRINSIC
transmembrane domain	934	956	N/A	INTRINSIC
transmembrane domain	976	998	N/A	INTRINSIC
transmembrane domain	1011	1030	N/A	INTRINSIC
transmembrane domain	1080	1102	N/A	INTRINSIC
transmembrane domain	1104	1126	N/A	INTRINSIC
Pfam:Pecanex_C	1603	1828	3.5e-113	PFAM
low complexity region	1864	1889	N/A	INTRINSIC
low complexity region	1968	1981	N/A	INTRINSIC
low complexity region	2004	2019	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119305

SMART Domains

Protein: ENSMUSP00000113149
Gene: ENSMUSG00000060212

Domain	Start	End	E-Value	Type
Pfam:Pecanex_C	157	386	1.8e-122	PFAM
low complexity region	421	446	N/A	INTRINSIC
low complexity region	525	538	N/A	INTRINSIC
low complexity region	561	576	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120589

SMART Domains

Protein: ENSMUSP00000113111
Gene: ENSMUSG00000060212

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
Pfam:Pecanex_C	533	762	4e-122	PFAM
low complexity region	797	822	N/A	INTRINSIC
low complexity region	901	914	N/A	INTRINSIC
low complexity region	937	952	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	C	5: 63,898,737	R272P	possibly damaging	Het
9130011E15Rik	A	T	19: 45,965,381	I188K	probably damaging	Het
Ablim3	A	T	18: 61,857,088	D83E	possibly damaging	Het
Aco1	G	A	4: 40,183,605	G508S	probably damaging	Het
Adamts13	C	A	2: 27,005,425	T1176N	probably benign	Het
Adgre5	T	C	8: 83,727,804	T357A	probably benign	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Ankrd33	T	C	15: 101,119,636	V310A	probably benign	Het
Bnipl	C	T	3: 95,244,211	G232E	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Cacna1s	G	A	1: 136,079,504	V173I	probably benign	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chrdl1	T	C	X: 143,303,418	I231V	probably benign	Het
Ciita	C	T	16: 10,518,353	T958I	probably benign	Het
Cnot1	G	T	8: 95,739,833	T1592K	possibly damaging	Het
Dcaf15	T	C	8: 84,101,741	D240G	probably damaging	Het
Ddx58	A	T	4: 40,224,069		probably null	Het
Dlgap1	C	T	17: 70,662,770	R524C	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dsg1c	A	G	18: 20,275,252	M453V	probably benign	Het
Ednrb	G	T	14: 103,817,099	N432K	probably benign	Het
Fcgbp	G	A	7: 28,120,389	G2514S	probably damaging	Het
Fez1	A	G	9: 36,867,945	K306R	probably benign	Het
Fmo4	A	G	1: 162,809,887	V12A	probably benign	Het
Fpgt	T	C	3: 155,087,874	Y172C	probably damaging	Het
Fsip2	T	A	2: 83,008,815	F6976I	possibly damaging	Het
Galnt12	C	T	4: 47,108,477	R205*	probably null	Het
Grik5	A	T	7: 25,015,313	M752K	possibly damaging	Het
Herc2	A	G	7: 56,226,964	N4516S	probably damaging	Het
Ifrd2	A	T	9: 107,592,545	D439V	probably damaging	Het
Igsf3	A	G	3: 101,439,515	T609A	probably benign	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
Lgi2	A	G	5: 52,538,505	S371P	probably damaging	Het
March3	A	T	18: 56,811,853	V56E	possibly damaging	Het
Mib2	T	C	4: 155,659,701	D168G	probably damaging	Het
Nhs	T	A	X: 161,842,721	H544L	probably damaging	Het
Nlrp2	A	G	7: 5,325,006	S683P	probably damaging	Het
Olfr1260	C	A	2: 89,978,213	T145K	probably benign	Het
Olfr1454	A	T	19: 13,063,680	M90L	probably benign	Het
Olfr527	T	C	7: 140,336,653	S264P	possibly damaging	Het
Onecut3	T	G	10: 80,495,014	L3V	unknown	Het
Otogl	C	T	10: 107,781,043	C1791Y	probably damaging	Het
Paip1	T	C	13: 119,430,262	V128A	possibly damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plxnb2	G	T	15: 89,158,451	R1545S	probably damaging	Het
Ppp4c	T	C	7: 126,787,348		probably null	Het
Prune1	C	T	3: 95,255,408	R318Q	probably benign	Het
Psg27	T	C	7: 18,560,417	D355G	probably damaging	Het
Psg27	A	G	7: 18,565,009	L129P	probably benign	Het
Psmc6	A	G	14: 45,329,866	K7E	possibly damaging	Het
Reln	A	T	5: 21,919,177	V2777E	probably damaging	Het
Scn11a	G	T	9: 119,811,208	A207E	possibly damaging	Het
Slc5a5	C	T	8: 70,892,439	G75R	possibly damaging	Het
Smarcd2	A	T	11: 106,265,307	L42*	probably null	Het
Smg1	T	C	7: 118,163,166		probably benign	Het
Smurf2	T	A	11: 106,841,769	Q335L	probably benign	Het
Sspo	A	T	6: 48,473,517	H2580L	probably benign	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Syt1	A	G	10: 108,583,972	I276T	probably damaging	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Taar9	A	T	10: 24,108,979	C186S	probably damaging	Het
Tnrc6b	C	T	15: 80,882,965	P977L	possibly damaging	Het
Trp53bp2	A	G	1: 182,458,867	T1091A	probably benign	Het
Ttn	G	T	2: 76,937,776	T2947N	probably damaging	Het
Ube2q1	T	C	3: 89,779,571		probably null	Het
Ube3c	A	G	5: 29,635,640	E671G	probably benign	Het
Upf3a	A	G	8: 13,785,850	K56R	possibly damaging	Het
Vmn2r15	A	T	5: 109,286,753	M695K	possibly damaging	Het
Vmn2r3	A	T	3: 64,275,072	M402K	possibly damaging	Het
Zfp354b	T	A	11: 50,922,452	R549*	probably null	Het
Zfp37	A	T	4: 62,191,708	M411K	probably damaging	Het
Zfp747	T	A	7: 127,373,970	T343S	possibly damaging	Het
Zfp853	T	A	5: 143,289,382	Q161L	unknown	Het

Other mutations in Pcnx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Pcnx2	APN	8	125887585	missense	probably damaging	1.00
IGL00900:Pcnx2	APN	8	125863236	splice site	probably benign
IGL01134:Pcnx2	APN	8	125863150	missense	probably benign
IGL01370:Pcnx2	APN	8	125801483	missense	probably damaging	0.96
IGL01452:Pcnx2	APN	8	125838032	missense	probably damaging	1.00
IGL01477:Pcnx2	APN	8	125785305	missense	probably damaging	1.00
IGL01610:Pcnx2	APN	8	125839633	missense	possibly damaging	0.67
IGL01640:Pcnx2	APN	8	125801558	missense	probably benign	0.14
IGL01645:Pcnx2	APN	8	125887917	missense	probably damaging	1.00
IGL01876:Pcnx2	APN	8	125866031	missense	probably benign	0.31
IGL01933:Pcnx2	APN	8	125761654	missense	probably damaging	1.00
IGL02208:Pcnx2	APN	8	125752155	missense	probably benign	0.30
IGL02573:Pcnx2	APN	8	125855273	missense	probably benign	0.34
IGL02810:Pcnx2	APN	8	125887203	missense	probably benign	0.03
IGL02859:Pcnx2	APN	8	125863173	missense	probably damaging	1.00
IGL02879:Pcnx2	APN	8	125772057	missense	probably damaging	1.00
IGL03202:Pcnx2	APN	8	125772044	missense	probably damaging	0.98
IGL03259:Pcnx2	APN	8	125753649	missense	probably benign	0.19
IGL03395:Pcnx2	APN	8	125887523	missense	probably benign	0.00
IGL03410:Pcnx2	APN	8	125887040	missense	probably damaging	1.00
gallen	UTSW	8	125891120	missense	probably damaging	1.00
hotzone	UTSW	8	125891141	missense	probably benign	0.00
R0107:Pcnx2	UTSW	8	125753586	missense	probably benign	0.29
R0477:Pcnx2	UTSW	8	125761567	missense	probably damaging	0.99
R0610:Pcnx2	UTSW	8	125839687	missense	probably damaging	1.00
R0645:Pcnx2	UTSW	8	125760720	missense	possibly damaging	0.64
R0894:Pcnx2	UTSW	8	125886926	splice site	probably benign
R1083:Pcnx2	UTSW	8	125772104	missense	probably damaging	1.00
R1199:Pcnx2	UTSW	8	125887314	missense	possibly damaging	0.60
R1296:Pcnx2	UTSW	8	125773833	missense	probably damaging	1.00
R1445:Pcnx2	UTSW	8	125752284	missense	probably damaging	0.99
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1467:Pcnx2	UTSW	8	125753550	missense	possibly damaging	0.77
R1524:Pcnx2	UTSW	8	125891141	missense	probably benign	0.00
R1537:Pcnx2	UTSW	8	125877449	missense	possibly damaging	0.94
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1574:Pcnx2	UTSW	8	125773930	missense	probably damaging	1.00
R1593:Pcnx2	UTSW	8	125759273	missense	probably benign	0.11
R1598:Pcnx2	UTSW	8	125772086	missense	probably benign	0.03
R1603:Pcnx2	UTSW	8	125839626	missense	probably damaging	1.00
R1697:Pcnx2	UTSW	8	125850348	missense	probably damaging	1.00
R1759:Pcnx2	UTSW	8	125773978	missense	probably damaging	1.00
R1855:Pcnx2	UTSW	8	125807996	splice site	probably benign
R1863:Pcnx2	UTSW	8	125818786	missense	probably damaging	0.98
R1930:Pcnx2	UTSW	8	125887714	missense	probably benign	0.10
R1967:Pcnx2	UTSW	8	125815683	missense	possibly damaging	0.51
R1974:Pcnx2	UTSW	8	125887371	missense	probably benign	0.00
R1998:Pcnx2	UTSW	8	125887143	missense	probably damaging	1.00
R2034:Pcnx2	UTSW	8	125818667	critical splice donor site	probably null
R2096:Pcnx2	UTSW	8	125759248	missense	probably benign	0.27
R2216:Pcnx2	UTSW	8	125888077	missense	probably benign	0.00
R2290:Pcnx2	UTSW	8	125877595	splice site	probably benign
R2373:Pcnx2	UTSW	8	125753451	missense	probably damaging	1.00
R2484:Pcnx2	UTSW	8	125891120	missense	probably damaging	1.00
R2849:Pcnx2	UTSW	8	125760927	missense	probably damaging	1.00
R2891:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2892:Pcnx2	UTSW	8	125891058	missense	probably damaging	1.00
R2970:Pcnx2	UTSW	8	125801536	missense	probably damaging	1.00
R3013:Pcnx2	UTSW	8	125887770	missense	probably benign	0.05
R3608:Pcnx2	UTSW	8	125888101	missense	probably benign
R3876:Pcnx2	UTSW	8	125888158	missense	probably benign
R4349:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4352:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4353:Pcnx2	UTSW	8	125762851	missense	probably damaging	0.98
R4361:Pcnx2	UTSW	8	125768298	nonsense	probably null
R4735:Pcnx2	UTSW	8	125828041	critical splice donor site	probably null
R4749:Pcnx2	UTSW	8	125887588	missense	probably damaging	1.00
R4812:Pcnx2	UTSW	8	125865939	missense	probably benign	0.00
R4819:Pcnx2	UTSW	8	125855230	missense	probably benign	0.04
R4829:Pcnx2	UTSW	8	125861058	splice site	probably null
R4832:Pcnx2	UTSW	8	125752188	missense	probably damaging	0.99
R4876:Pcnx2	UTSW	8	125772108	missense	probably damaging	1.00
R4974:Pcnx2	UTSW	8	125851130	missense	probably benign	0.00
R5057:Pcnx2	UTSW	8	125855191	missense	possibly damaging	0.95
R5078:Pcnx2	UTSW	8	125752156	missense	probably benign
R5114:Pcnx2	UTSW	8	125838010	missense	possibly damaging	0.89
R5195:Pcnx2	UTSW	8	125801549	missense	possibly damaging	0.69
R5239:Pcnx2	UTSW	8	125861082	splice site	probably null
R5348:Pcnx2	UTSW	8	125818756	missense	probably damaging	1.00
R5398:Pcnx2	UTSW	8	125887948	missense	possibly damaging	0.63
R5448:Pcnx2	UTSW	8	125888149	missense	probably benign	0.14
R5534:Pcnx2	UTSW	8	125838015	missense	possibly damaging	0.65
R5624:Pcnx2	UTSW	8	125761523	critical splice donor site	probably null
R5629:Pcnx2	UTSW	8	125898041	missense	probably damaging	1.00
R5630:Pcnx2	UTSW	8	125860958	missense	probably damaging	0.99
R5782:Pcnx2	UTSW	8	125753484	missense	probably damaging	1.00
R5877:Pcnx2	UTSW	8	125753728	missense	probably damaging	0.99
R5879:Pcnx2	UTSW	8	125773946	missense	probably damaging	1.00
R6114:Pcnx2	UTSW	8	125773947	missense	probably damaging	1.00
R6152:Pcnx2	UTSW	8	125753752	missense	probably damaging	0.99
R6154:Pcnx2	UTSW	8	125762813	missense	probably damaging	1.00
R6283:Pcnx2	UTSW	8	125877586	missense	probably damaging	0.99
R6500:Pcnx2	UTSW	8	125753485	missense	probably damaging	1.00
R6629:Pcnx2	UTSW	8	125891112	missense	probably benign	0.00
R6708:Pcnx2	UTSW	8	125860953	critical splice donor site	probably null
R6736:Pcnx2	UTSW	8	125752317	splice site	probably null
R6748:Pcnx2	UTSW	8	125850335	missense	probably damaging	1.00
R6788:Pcnx2	UTSW	8	125772100	missense	probably damaging	1.00
R6849:Pcnx2	UTSW	8	125861210	missense	probably damaging	1.00
R6947:Pcnx2	UTSW	8	125850282	critical splice donor site	probably null
R7034:Pcnx2	UTSW	8	125785302	missense	probably damaging	1.00
R7100:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R7124:Pcnx2	UTSW	8	125753617	missense	probably damaging	0.99
R7130:Pcnx2	UTSW	8	125753584	nonsense	probably null
R7133:Pcnx2	UTSW	8	125801504	missense	probably benign	0.01
R7271:Pcnx2	UTSW	8	125886951	missense	probably benign
R7326:Pcnx2	UTSW	8	125887083	missense	probably damaging	1.00
R7373:Pcnx2	UTSW	8	125808027	missense	probably damaging	1.00
R7397:Pcnx2	UTSW	8	125890885	splice site	probably null
R7662:Pcnx2	UTSW	8	125818771	nonsense	probably null
R7693:Pcnx2	UTSW	8	125887125	missense	probably benign	0.09
R7726:Pcnx2	UTSW	8	125850330	missense	probably benign	0.00
R7745:Pcnx2	UTSW	8	125851107	missense	probably benign	0.04
R7792:Pcnx2	UTSW	8	125892018	missense	possibly damaging	0.63
R7797:Pcnx2	UTSW	8	125785348	missense	possibly damaging	0.70
R7921:Pcnx2	UTSW	8	125837863	missense	probably benign
R7984:Pcnx2	UTSW	8	125759126	missense	probably benign
R8098:Pcnx2	UTSW	8	125768301	missense	probably damaging	1.00
R8277:Pcnx2	UTSW	8	125866016	missense	probably damaging	1.00
R8312:Pcnx2	UTSW	8	125762850	missense	possibly damaging	0.69
R8354:Pcnx2	UTSW	8	125761618	missense	probably damaging	0.99
R8378:Pcnx2	UTSW	8	125760910	missense	probably damaging	1.00
R8713:Pcnx2	UTSW	8	125818786	missense	probably damaging	1.00
R8714:Pcnx2	UTSW	8	125773807	missense	probably benign
R8753:Pcnx2	UTSW	8	125887260	missense	probably benign	0.15
R8790:Pcnx2	UTSW	8	125877567	missense	probably benign
R8925:Pcnx2	UTSW	8	125887920	missense	probably benign	0.01
R8927:Pcnx2	UTSW	8	125887920	missense	probably benign	0.01
R8965:Pcnx2	UTSW	8	125759114	missense	probably benign	0.16
R9006:Pcnx2	UTSW	8	125887257	missense	probably benign	0.00
R9082:Pcnx2	UTSW	8	125887014	missense	probably damaging	1.00
R9202:Pcnx2	UTSW	8	125889677	critical splice acceptor site	probably null
R9315:Pcnx2	UTSW	8	125887380	missense	probably benign	0.00
R9434:Pcnx2	UTSW	8	125815773	missense	probably benign	0.00
R9660:Pcnx2	UTSW	8	125760853	missense	probably damaging	1.00
R9686:Pcnx2	UTSW	8	125866027	missense	probably benign
R9766:Pcnx2	UTSW	8	125761574	missense	probably damaging	1.00
R9778:Pcnx2	UTSW	8	125785437	missense	probably benign	0.00
R9792:Pcnx2	UTSW	8	125808081	missense	probably damaging	0.99
RF018:Pcnx2	UTSW	8	125877519	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125826928	missense	probably damaging	1.00
Z1088:Pcnx2	UTSW	8	125866018	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125761654	missense	probably damaging	1.00
Z1176:Pcnx2	UTSW	8	125838014	missense	probably benign	0.30
Z1177:Pcnx2	UTSW	8	125887960	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGATGACCTTGAAGCTCAGGAAG -3'
(R):5'- ACAATGAGTTGAGATGCCCTG -3'

Sequencing Primer
(F):5'- GGAGCATGATGACCTTGTACTCATC -3'
(R):5'- AGTTGAGATGCCCTGAGTACC -3'

Posted On

2014-09-17