Incidental Mutation 'R2072:Otogl'
ID 227248
Institutional Source Beutler Lab
Gene Symbol Otogl
Ensembl Gene ENSMUSG00000091455
Gene Name otogelin-like
Synonyms Gm6924
MMRRC Submission 040077-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2072 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 107760531-107912134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 107781043 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 1791 (C1791Y)
Ref Sequence ENSEMBL: ENSMUSP00000129467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165341]
AlphaFold F7A4A7
Predicted Effect probably damaging
Transcript: ENSMUST00000165341
AA Change: C1791Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: C1791Y

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
EGF_like 71 101 3.36e1 SMART
VWD 104 264 4.74e-29 SMART
C8 305 378 6.13e-6 SMART
VWD 463 625 7e-41 SMART
C8 668 733 3.6e-3 SMART
Pfam:TIL 736 791 2.3e-11 PFAM
SCOP:d1coua_ 833 911 1e-6 SMART
VWD 928 1085 1.29e-30 SMART
C8 1120 1194 1.81e-26 SMART
Pfam:AbfB 1230 1350 1.2e-10 PFAM
Pfam:TIL 1364 1418 6.1e-8 PFAM
VWD 1497 1671 2.34e-10 SMART
C8 1705 1775 9.56e-17 SMART
Pfam:TIL 1778 1836 1.6e-8 PFAM
low complexity region 1870 1886 N/A INTRINSIC
CT 2242 2325 6.9e-14 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 63,898,737 (GRCm38) R272P possibly damaging Het
Ablim3 A T 18: 61,857,088 (GRCm38) D83E possibly damaging Het
Aco1 G A 4: 40,183,605 (GRCm38) G508S probably damaging Het
Adamts13 C A 2: 27,005,425 (GRCm38) T1176N probably benign Het
Adgre5 T C 8: 83,727,804 (GRCm38) T357A probably benign Het
Akap8l C T 17: 32,332,483 (GRCm38) R511H probably damaging Het
Ankrd33 T C 15: 101,119,636 (GRCm38) V310A probably benign Het
Armh3 A T 19: 45,965,381 (GRCm38) I188K probably damaging Het
Bnipl C T 3: 95,244,211 (GRCm38) G232E probably damaging Het
Btbd17 A T 11: 114,791,952 (GRCm38) probably null Het
Cacna1s G A 1: 136,079,504 (GRCm38) V173I probably benign Het
Ccdc122 T C 14: 77,068,951 (GRCm38) probably null Het
Ces1a T A 8: 93,048,075 (GRCm38) N12Y probably benign Het
Chrdl1 T C X: 143,303,418 (GRCm38) I231V probably benign Het
Ciita C T 16: 10,518,353 (GRCm38) T958I probably benign Het
Cnot1 G T 8: 95,739,833 (GRCm38) T1592K possibly damaging Het
Dcaf15 T C 8: 84,101,741 (GRCm38) D240G probably damaging Het
Dlgap1 C T 17: 70,662,770 (GRCm38) R524C probably damaging Het
Dmd G C X: 84,312,483 (GRCm38) A2257P probably benign Het
Dsg1c A G 18: 20,275,252 (GRCm38) M453V probably benign Het
Ednrb G T 14: 103,817,099 (GRCm38) N432K probably benign Het
Fcgbp G A 7: 28,120,389 (GRCm38) G2514S probably damaging Het
Fez1 A G 9: 36,867,945 (GRCm38) K306R probably benign Het
Fmo4 A G 1: 162,809,887 (GRCm38) V12A probably benign Het
Fpgt T C 3: 155,087,874 (GRCm38) Y172C probably damaging Het
Fsip2 T A 2: 83,008,815 (GRCm38) F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 (GRCm38) R205* probably null Het
Grik5 A T 7: 25,015,313 (GRCm38) M752K possibly damaging Het
Herc2 A G 7: 56,226,964 (GRCm38) N4516S probably damaging Het
Ifrd2 A T 9: 107,592,545 (GRCm38) D439V probably damaging Het
Igsf3 A G 3: 101,439,515 (GRCm38) T609A probably benign Het
Kif5a T C 10: 127,245,369 (GRCm38) D232G probably damaging Het
Lgi2 A G 5: 52,538,505 (GRCm38) S371P probably damaging Het
Marchf3 A T 18: 56,811,853 (GRCm38) V56E possibly damaging Het
Mib2 T C 4: 155,659,701 (GRCm38) D168G probably damaging Het
Nhs T A X: 161,842,721 (GRCm38) H544L probably damaging Het
Nlrp2 A G 7: 5,325,006 (GRCm38) S683P probably damaging Het
Onecut3 T G 10: 80,495,014 (GRCm38) L3V unknown Het
Or12j2 T C 7: 140,336,653 (GRCm38) S264P possibly damaging Het
Or4c35 C A 2: 89,978,213 (GRCm38) T145K probably benign Het
Or5b102 A T 19: 13,063,680 (GRCm38) M90L probably benign Het
Paip1 T C 13: 119,430,262 (GRCm38) V128A possibly damaging Het
Pcnx2 A T 8: 125,761,742 (GRCm38) C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,819 (GRCm38) L955P probably damaging Het
Phlpp2 T C 8: 109,928,492 (GRCm38) S605P possibly damaging Het
Pkhd1l1 G T 15: 44,558,639 (GRCm38) A3102S probably damaging Het
Plxnb2 G T 15: 89,158,451 (GRCm38) R1545S probably damaging Het
Ppp4c T C 7: 126,787,348 (GRCm38) probably null Het
Prune1 C T 3: 95,255,408 (GRCm38) R318Q probably benign Het
Psg27 A G 7: 18,565,009 (GRCm38) L129P probably benign Het
Psg27 T C 7: 18,560,417 (GRCm38) D355G probably damaging Het
Psmc6 A G 14: 45,329,866 (GRCm38) K7E possibly damaging Het
Reln A T 5: 21,919,177 (GRCm38) V2777E probably damaging Het
Rigi A T 4: 40,224,069 (GRCm38) probably null Het
Scn11a G T 9: 119,811,208 (GRCm38) A207E possibly damaging Het
Slc5a5 C T 8: 70,892,439 (GRCm38) G75R possibly damaging Het
Smarcd2 A T 11: 106,265,307 (GRCm38) L42* probably null Het
Smg1 T C 7: 118,163,166 (GRCm38) probably benign Het
Smurf2 T A 11: 106,841,769 (GRCm38) Q335L probably benign Het
Sspo A T 6: 48,473,517 (GRCm38) H2580L probably benign Het
Stk3 T C 15: 34,959,049 (GRCm38) M256V possibly damaging Het
Syt1 A G 10: 108,583,972 (GRCm38) I276T probably damaging Het
Syt10 C T 15: 89,790,776 (GRCm38) D456N probably damaging Het
Taar9 A T 10: 24,108,979 (GRCm38) C186S probably damaging Het
Tnrc6b C T 15: 80,882,965 (GRCm38) P977L possibly damaging Het
Trp53bp2 A G 1: 182,458,867 (GRCm38) T1091A probably benign Het
Ttn G T 2: 76,937,776 (GRCm38) T2947N probably damaging Het
Ube2q1 T C 3: 89,779,571 (GRCm38) probably null Het
Ube3c A G 5: 29,635,640 (GRCm38) E671G probably benign Het
Upf3a A G 8: 13,785,850 (GRCm38) K56R possibly damaging Het
Vmn2r15 A T 5: 109,286,753 (GRCm38) M695K possibly damaging Het
Vmn2r3 A T 3: 64,275,072 (GRCm38) M402K possibly damaging Het
Zfp354b T A 11: 50,922,452 (GRCm38) R549* probably null Het
Zfp37 A T 4: 62,191,708 (GRCm38) M411K probably damaging Het
Zfp747 T A 7: 127,373,970 (GRCm38) T343S possibly damaging Het
Zfp853 T A 5: 143,289,382 (GRCm38) Q161L unknown Het
Other mutations in Otogl
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8562:Otogl UTSW 10 107,910,956 (GRCm38) missense probably benign 0.00
R0084:Otogl UTSW 10 107,901,341 (GRCm38) missense probably damaging 0.96
R0164:Otogl UTSW 10 107,874,530 (GRCm38) missense probably damaging 0.97
R0164:Otogl UTSW 10 107,874,530 (GRCm38) missense probably damaging 0.97
R0238:Otogl UTSW 10 107,806,696 (GRCm38) missense probably damaging 0.98
R0238:Otogl UTSW 10 107,806,696 (GRCm38) missense probably damaging 0.98
R0239:Otogl UTSW 10 107,806,696 (GRCm38) missense probably damaging 0.98
R0239:Otogl UTSW 10 107,806,696 (GRCm38) missense probably damaging 0.98
R0294:Otogl UTSW 10 107,777,228 (GRCm38) missense probably damaging 1.00
R0360:Otogl UTSW 10 107,770,650 (GRCm38) splice site probably benign
R0442:Otogl UTSW 10 107,876,855 (GRCm38) missense probably damaging 1.00
R0488:Otogl UTSW 10 107,803,605 (GRCm38) missense probably benign 0.02
R0507:Otogl UTSW 10 107,866,740 (GRCm38) missense possibly damaging 0.51
R0573:Otogl UTSW 10 107,780,988 (GRCm38) missense probably benign 0.00
R0581:Otogl UTSW 10 107,789,040 (GRCm38) missense possibly damaging 0.79
R0613:Otogl UTSW 10 107,817,070 (GRCm38) missense probably damaging 0.99
R0614:Otogl UTSW 10 107,798,355 (GRCm38) missense probably benign 0.14
R0742:Otogl UTSW 10 107,866,740 (GRCm38) missense possibly damaging 0.51
R0846:Otogl UTSW 10 107,772,296 (GRCm38) missense probably benign 0.40
R1146:Otogl UTSW 10 107,886,513 (GRCm38) missense probably damaging 1.00
R1146:Otogl UTSW 10 107,886,513 (GRCm38) missense probably damaging 1.00
R1439:Otogl UTSW 10 107,779,252 (GRCm38) missense probably benign 0.02
R1457:Otogl UTSW 10 107,878,152 (GRCm38) splice site probably null
R1526:Otogl UTSW 10 107,869,526 (GRCm38) missense probably damaging 1.00
R1662:Otogl UTSW 10 107,798,357 (GRCm38) missense possibly damaging 0.84
R1664:Otogl UTSW 10 107,806,576 (GRCm38) missense probably benign 0.00
R1667:Otogl UTSW 10 107,813,965 (GRCm38) nonsense probably null
R1695:Otogl UTSW 10 107,814,017 (GRCm38) missense probably damaging 0.99
R1731:Otogl UTSW 10 107,817,111 (GRCm38) missense probably damaging 1.00
R1733:Otogl UTSW 10 107,783,712 (GRCm38) missense possibly damaging 0.46
R1764:Otogl UTSW 10 107,899,461 (GRCm38) nonsense probably null
R1824:Otogl UTSW 10 107,779,831 (GRCm38) missense probably benign
R1850:Otogl UTSW 10 107,878,064 (GRCm38) missense probably damaging 1.00
R1856:Otogl UTSW 10 107,854,264 (GRCm38) missense possibly damaging 0.92
R1875:Otogl UTSW 10 107,899,590 (GRCm38) missense probably damaging 1.00
R1938:Otogl UTSW 10 107,777,575 (GRCm38) missense probably damaging 0.98
R1986:Otogl UTSW 10 107,794,190 (GRCm38) critical splice acceptor site probably null
R2117:Otogl UTSW 10 107,858,918 (GRCm38) missense probably benign 0.06
R2219:Otogl UTSW 10 107,856,977 (GRCm38) missense probably damaging 1.00
R2508:Otogl UTSW 10 107,874,500 (GRCm38) missense probably damaging 0.99
R2883:Otogl UTSW 10 107,768,981 (GRCm38) missense probably damaging 1.00
R2931:Otogl UTSW 10 107,820,004 (GRCm38) missense possibly damaging 0.85
R3620:Otogl UTSW 10 107,874,371 (GRCm38) missense probably damaging 0.99
R3621:Otogl UTSW 10 107,874,371 (GRCm38) missense probably damaging 0.99
R3735:Otogl UTSW 10 107,899,529 (GRCm38) nonsense probably null
R3812:Otogl UTSW 10 107,899,471 (GRCm38) missense probably damaging 1.00
R3880:Otogl UTSW 10 107,827,704 (GRCm38) missense probably damaging 0.96
R3958:Otogl UTSW 10 107,821,925 (GRCm38) missense probably damaging 1.00
R4063:Otogl UTSW 10 107,790,649 (GRCm38) missense probably benign 0.02
R4064:Otogl UTSW 10 107,790,649 (GRCm38) missense probably benign 0.02
R4108:Otogl UTSW 10 107,771,244 (GRCm38) missense probably benign 0.01
R4352:Otogl UTSW 10 107,869,535 (GRCm38) missense probably damaging 1.00
R4526:Otogl UTSW 10 107,886,980 (GRCm38) missense probably damaging 1.00
R4614:Otogl UTSW 10 107,892,124 (GRCm38) nonsense probably null
R4703:Otogl UTSW 10 107,821,924 (GRCm38) missense probably damaging 1.00
R4741:Otogl UTSW 10 107,779,260 (GRCm38) missense probably benign 0.00
R4790:Otogl UTSW 10 107,822,033 (GRCm38) critical splice acceptor site probably null
R4801:Otogl UTSW 10 107,901,336 (GRCm38) missense probably damaging 1.00
R4802:Otogl UTSW 10 107,901,336 (GRCm38) missense probably damaging 1.00
R4910:Otogl UTSW 10 107,879,517 (GRCm38) missense probably benign 0.05
R4913:Otogl UTSW 10 107,876,855 (GRCm38) missense probably damaging 0.98
R5238:Otogl UTSW 10 107,768,973 (GRCm38) missense probably damaging 1.00
R5261:Otogl UTSW 10 107,777,592 (GRCm38) missense probably benign 0.16
R5387:Otogl UTSW 10 107,780,933 (GRCm38) missense probably benign 0.03
R5395:Otogl UTSW 10 107,817,138 (GRCm38) missense probably benign 0.39
R5403:Otogl UTSW 10 107,808,756 (GRCm38) missense probably benign 0.08
R5482:Otogl UTSW 10 107,821,941 (GRCm38) missense probably damaging 0.99
R5547:Otogl UTSW 10 107,782,048 (GRCm38) missense possibly damaging 0.55
R5611:Otogl UTSW 10 107,786,769 (GRCm38) missense probably damaging 1.00
R5642:Otogl UTSW 10 107,886,552 (GRCm38) missense probably benign 0.44
R5690:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R5711:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R5731:Otogl UTSW 10 107,881,464 (GRCm38) missense probably damaging 0.98
R5743:Otogl UTSW 10 107,857,001 (GRCm38) missense possibly damaging 0.67
R5782:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R5820:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R5897:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R6004:Otogl UTSW 10 107,879,529 (GRCm38) missense probably damaging 1.00
R6145:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R6146:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R6147:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R6149:Otogl UTSW 10 107,881,453 (GRCm38) missense probably benign 0.36
R6226:Otogl UTSW 10 107,771,206 (GRCm38) nonsense probably null
R6283:Otogl UTSW 10 107,790,500 (GRCm38) missense probably damaging 0.98
R6414:Otogl UTSW 10 107,782,050 (GRCm38) missense probably damaging 1.00
R6604:Otogl UTSW 10 107,822,034 (GRCm38) splice site probably null
R6634:Otogl UTSW 10 107,862,304 (GRCm38) missense probably damaging 1.00
R6727:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R6755:Otogl UTSW 10 107,853,303 (GRCm38) nonsense probably null
R6795:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R6797:Otogl UTSW 10 107,777,117 (GRCm38) synonymous silent
R6864:Otogl UTSW 10 107,827,806 (GRCm38) missense probably damaging 0.96
R6924:Otogl UTSW 10 107,808,641 (GRCm38) missense probably damaging 1.00
R6967:Otogl UTSW 10 107,814,050 (GRCm38) missense probably benign 0.01
R7000:Otogl UTSW 10 107,779,831 (GRCm38) missense probably benign
R7075:Otogl UTSW 10 107,778,929 (GRCm38) missense probably benign 0.16
R7122:Otogl UTSW 10 107,866,654 (GRCm38) missense probably benign 0.08
R7176:Otogl UTSW 10 107,778,911 (GRCm38) missense probably damaging 1.00
R7184:Otogl UTSW 10 107,763,200 (GRCm38) missense probably damaging 1.00
R7199:Otogl UTSW 10 107,874,533 (GRCm38) missense possibly damaging 0.88
R7252:Otogl UTSW 10 107,821,943 (GRCm38) missense probably benign 0.06
R7286:Otogl UTSW 10 107,770,610 (GRCm38) missense probably benign 0.00
R7373:Otogl UTSW 10 107,901,251 (GRCm38) missense probably damaging 1.00
R7449:Otogl UTSW 10 107,803,663 (GRCm38) missense probably damaging 1.00
R7486:Otogl UTSW 10 107,821,988 (GRCm38) missense probably damaging 1.00
R7493:Otogl UTSW 10 107,886,982 (GRCm38) missense probably benign 0.06
R7659:Otogl UTSW 10 107,777,120 (GRCm38) missense probably benign 0.19
R7732:Otogl UTSW 10 107,806,664 (GRCm38) missense probably benign 0.01
R7754:Otogl UTSW 10 107,869,546 (GRCm38) missense probably damaging 0.99
R7757:Otogl UTSW 10 107,876,921 (GRCm38) missense probably damaging 1.00
R7800:Otogl UTSW 10 107,886,515 (GRCm38) missense probably damaging 0.99
R7864:Otogl UTSW 10 107,869,567 (GRCm38) missense probably damaging 1.00
R7879:Otogl UTSW 10 107,777,109 (GRCm38) missense probably benign 0.00
R7941:Otogl UTSW 10 107,806,802 (GRCm38) splice site probably null
R7956:Otogl UTSW 10 107,878,026 (GRCm38) missense possibly damaging 0.62
R7988:Otogl UTSW 10 107,895,776 (GRCm38) missense probably damaging 1.00
R8057:Otogl UTSW 10 107,808,615 (GRCm38) missense probably benign 0.00
R8058:Otogl UTSW 10 107,762,426 (GRCm38) missense probably damaging 1.00
R8127:Otogl UTSW 10 107,895,752 (GRCm38) missense probably damaging 1.00
R8143:Otogl UTSW 10 107,806,666 (GRCm38) missense probably damaging 1.00
R8310:Otogl UTSW 10 107,777,600 (GRCm38) missense possibly damaging 0.94
R8319:Otogl UTSW 10 107,853,266 (GRCm38) critical splice donor site probably null
R8339:Otogl UTSW 10 107,789,536 (GRCm38) missense probably benign 0.34
R8339:Otogl UTSW 10 107,789,535 (GRCm38) missense probably damaging 0.99
R8394:Otogl UTSW 10 107,886,465 (GRCm38) critical splice donor site probably null
R8428:Otogl UTSW 10 107,798,736 (GRCm38) missense probably damaging 1.00
R8444:Otogl UTSW 10 107,857,114 (GRCm38) missense probably benign 0.01
R8501:Otogl UTSW 10 107,790,560 (GRCm38) missense probably benign
R8503:Otogl UTSW 10 107,892,126 (GRCm38) missense probably damaging 1.00
R8680:Otogl UTSW 10 107,912,075 (GRCm38) critical splice donor site probably null
R9025:Otogl UTSW 10 107,777,571 (GRCm38) missense probably damaging 0.99
R9090:Otogl UTSW 10 107,817,113 (GRCm38) missense probably null 0.99
R9223:Otogl UTSW 10 107,854,344 (GRCm38) missense probably damaging 0.99
R9268:Otogl UTSW 10 107,781,056 (GRCm38) missense probably damaging 1.00
R9271:Otogl UTSW 10 107,817,113 (GRCm38) missense probably null 0.99
R9356:Otogl UTSW 10 107,782,029 (GRCm38) missense probably damaging 1.00
R9484:Otogl UTSW 10 107,901,295 (GRCm38) missense probably damaging 1.00
R9484:Otogl UTSW 10 107,822,033 (GRCm38) critical splice acceptor site probably null
R9571:Otogl UTSW 10 107,762,503 (GRCm38) missense possibly damaging 0.94
R9731:Otogl UTSW 10 107,899,467 (GRCm38) missense probably damaging 1.00
X0065:Otogl UTSW 10 107,895,782 (GRCm38) missense probably damaging 1.00
X0067:Otogl UTSW 10 107,866,677 (GRCm38) missense probably damaging 1.00
Z1176:Otogl UTSW 10 107,778,873 (GRCm38) missense probably damaging 0.97
Z1176:Otogl UTSW 10 107,777,213 (GRCm38) missense probably benign
Z1176:Otogl UTSW 10 107,789,032 (GRCm38) missense probably benign 0.00
Z1177:Otogl UTSW 10 107,853,397 (GRCm38) missense possibly damaging 0.78
Z1177:Otogl UTSW 10 107,763,258 (GRCm38) nonsense probably null
Z1177:Otogl UTSW 10 107,876,903 (GRCm38) missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ATCTCTGAGCCATCATTTGATACTC -3'
(R):5'- ACCTAGATACTTGAAGGATGCC -3'

Sequencing Primer
(F):5'- TGAGCCATCATTTGATACTCTAGTC -3'
(R):5'- CTTTATTGTCTACAGCTCTGAG -3'
Posted On 2014-09-17