Mutagenetix > Incidental Mutation

Incidental Mutation 'R2072:Kif5a'

227250

Institutional Source

Beutler Lab

Gene Symbol

Kif5a

Ensembl Gene

ENSMUSG00000074657

Gene Name

kinesin family member 5A

Synonyms

Khc, Kns, Kif5, D10Bwg0738e

MMRRC Submission

040077-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2072 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

127225696-127263348 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 127245369 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 232 (D232G)

Ref Sequence

ENSEMBL: ENSMUSP00000151402 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099172] [ENSMUST00000217895] [ENSMUST00000218298]

AlphaFold

P33175

Predicted Effect

probably damaging
Transcript: ENSMUST00000099172
AA Change: D232G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000096775
Gene: ENSMUSG00000074657
AA Change: D232G

Domain	Start	End	E-Value	Type
KISc	7	335	7.38e-173	SMART
low complexity region	340	362	N/A	INTRINSIC
coiled coil region	408	539	N/A	INTRINSIC
low complexity region	591	603	N/A	INTRINSIC
coiled coil region	632	800	N/A	INTRINSIC
coiled coil region	822	905	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217895
AA Change: D232G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably benign
Transcript: ENSMUST00000218298

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of proteins. Members of this family are part of a multisubunit complex that functions as a microtubule motor in intracellular organelle transport. Mutations in this gene cause autosomal dominant spastic paraplegia 10. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes complete neonatal lethality. Homozygotes delivered by caesarian section are alive at E18.5 but usually die within minutes after birth, exhibiting an abnormal breathing pattern, atelectasis, cyanosis, and abnormal motor neuron morphology in the spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	C	5: 63,898,737	R272P	possibly damaging	Het
9130011E15Rik	A	T	19: 45,965,381	I188K	probably damaging	Het
Ablim3	A	T	18: 61,857,088	D83E	possibly damaging	Het
Aco1	G	A	4: 40,183,605	G508S	probably damaging	Het
Adamts13	C	A	2: 27,005,425	T1176N	probably benign	Het
Adgre5	T	C	8: 83,727,804	T357A	probably benign	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Ankrd33	T	C	15: 101,119,636	V310A	probably benign	Het
Bnipl	C	T	3: 95,244,211	G232E	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Cacna1s	G	A	1: 136,079,504	V173I	probably benign	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chrdl1	T	C	X: 143,303,418	I231V	probably benign	Het
Ciita	C	T	16: 10,518,353	T958I	probably benign	Het
Cnot1	G	T	8: 95,739,833	T1592K	possibly damaging	Het
Dcaf15	T	C	8: 84,101,741	D240G	probably damaging	Het
Ddx58	A	T	4: 40,224,069		probably null	Het
Dlgap1	C	T	17: 70,662,770	R524C	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dsg1c	A	G	18: 20,275,252	M453V	probably benign	Het
Ednrb	G	T	14: 103,817,099	N432K	probably benign	Het
Fcgbp	G	A	7: 28,120,389	G2514S	probably damaging	Het
Fez1	A	G	9: 36,867,945	K306R	probably benign	Het
Fmo4	A	G	1: 162,809,887	V12A	probably benign	Het
Fpgt	T	C	3: 155,087,874	Y172C	probably damaging	Het
Fsip2	T	A	2: 83,008,815	F6976I	possibly damaging	Het
Galnt12	C	T	4: 47,108,477	R205*	probably null	Het
Grik5	A	T	7: 25,015,313	M752K	possibly damaging	Het
Herc2	A	G	7: 56,226,964	N4516S	probably damaging	Het
Ifrd2	A	T	9: 107,592,545	D439V	probably damaging	Het
Igsf3	A	G	3: 101,439,515	T609A	probably benign	Het
Lgi2	A	G	5: 52,538,505	S371P	probably damaging	Het
March3	A	T	18: 56,811,853	V56E	possibly damaging	Het
Mib2	T	C	4: 155,659,701	D168G	probably damaging	Het
Nhs	T	A	X: 161,842,721	H544L	probably damaging	Het
Nlrp2	A	G	7: 5,325,006	S683P	probably damaging	Het
Olfr1260	C	A	2: 89,978,213	T145K	probably benign	Het
Olfr1454	A	T	19: 13,063,680	M90L	probably benign	Het
Olfr527	T	C	7: 140,336,653	S264P	possibly damaging	Het
Onecut3	T	G	10: 80,495,014	L3V	unknown	Het
Otogl	C	T	10: 107,781,043	C1791Y	probably damaging	Het
Paip1	T	C	13: 119,430,262	V128A	possibly damaging	Het
Pcnx2	A	T	8: 125,761,742	C1688S	possibly damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plxnb2	G	T	15: 89,158,451	R1545S	probably damaging	Het
Ppp4c	T	C	7: 126,787,348		probably null	Het
Prune1	C	T	3: 95,255,408	R318Q	probably benign	Het
Psg27	T	C	7: 18,560,417	D355G	probably damaging	Het
Psg27	A	G	7: 18,565,009	L129P	probably benign	Het
Psmc6	A	G	14: 45,329,866	K7E	possibly damaging	Het
Reln	A	T	5: 21,919,177	V2777E	probably damaging	Het
Scn11a	G	T	9: 119,811,208	A207E	possibly damaging	Het
Slc5a5	C	T	8: 70,892,439	G75R	possibly damaging	Het
Smarcd2	A	T	11: 106,265,307	L42*	probably null	Het
Smg1	T	C	7: 118,163,166		probably benign	Het
Smurf2	T	A	11: 106,841,769	Q335L	probably benign	Het
Sspo	A	T	6: 48,473,517	H2580L	probably benign	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Syt1	A	G	10: 108,583,972	I276T	probably damaging	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Taar9	A	T	10: 24,108,979	C186S	probably damaging	Het
Tnrc6b	C	T	15: 80,882,965	P977L	possibly damaging	Het
Trp53bp2	A	G	1: 182,458,867	T1091A	probably benign	Het
Ttn	G	T	2: 76,937,776	T2947N	probably damaging	Het
Ube2q1	T	C	3: 89,779,571		probably null	Het
Ube3c	A	G	5: 29,635,640	E671G	probably benign	Het
Upf3a	A	G	8: 13,785,850	K56R	possibly damaging	Het
Vmn2r15	A	T	5: 109,286,753	M695K	possibly damaging	Het
Vmn2r3	A	T	3: 64,275,072	M402K	possibly damaging	Het
Zfp354b	T	A	11: 50,922,452	R549*	probably null	Het
Zfp37	A	T	4: 62,191,708	M411K	probably damaging	Het
Zfp747	T	A	7: 127,373,970	T343S	possibly damaging	Het
Zfp853	T	A	5: 143,289,382	Q161L	unknown	Het

Other mutations in Kif5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Kif5a	APN	10	127239196	missense	probably benign
IGL01405:Kif5a	APN	10	127245990	missense	probably damaging	1.00
IGL01637:Kif5a	APN	10	127245368	missense	possibly damaging	0.94
IGL01894:Kif5a	APN	10	127262779	missense	probably benign	0.04
IGL01978:Kif5a	APN	10	127245739	missense	probably benign
IGL02039:Kif5a	APN	10	127233867	missense	possibly damaging	0.95
IGL02052:Kif5a	APN	10	127243499	missense	probably damaging	1.00
IGL02336:Kif5a	APN	10	127242696	missense	possibly damaging	0.87
IGL02352:Kif5a	APN	10	127243501	missense	probably damaging	1.00
IGL02359:Kif5a	APN	10	127243501	missense	probably damaging	1.00
IGL02834:Kif5a	APN	10	127245756	missense	probably benign	0.00
IGL03101:Kif5a	APN	10	127235609	unclassified	probably benign
brittany	UTSW	10	127248254	missense	probably damaging	1.00
spaniel	UTSW	10	127230578	missense	probably benign	0.00
R0463:Kif5a	UTSW	10	127235652	missense	probably benign	0.00
R0790:Kif5a	UTSW	10	127246009	intron	probably benign
R1070:Kif5a	UTSW	10	127245406	missense	probably benign	0.00
R1404:Kif5a	UTSW	10	127245442	missense	probably benign	0.12
R1404:Kif5a	UTSW	10	127245442	missense	probably benign	0.12
R1502:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R1812:Kif5a	UTSW	10	127242010	missense	probably benign	0.03
R1837:Kif5a	UTSW	10	127236815	nonsense	probably null
R1838:Kif5a	UTSW	10	127236815	nonsense	probably null
R2012:Kif5a	UTSW	10	127239175	missense	probably benign
R2073:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2074:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2075:Kif5a	UTSW	10	127245369	missense	probably damaging	0.99
R2440:Kif5a	UTSW	10	127231336	missense	probably benign	0.34
R3157:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R3688:Kif5a	UTSW	10	127242774	missense	probably damaging	1.00
R3740:Kif5a	UTSW	10	127243468	missense	probably damaging	1.00
R4782:Kif5a	UTSW	10	127230954	missense	probably benign	0.01
R5049:Kif5a	UTSW	10	127239839	missense	possibly damaging	0.93
R5723:Kif5a	UTSW	10	127231029	frame shift	probably null
R5764:Kif5a	UTSW	10	127231029	frame shift	probably null
R5838:Kif5a	UTSW	10	127245441	missense	probably damaging	1.00
R5903:Kif5a	UTSW	10	127230578	missense	probably benign	0.00
R6299:Kif5a	UTSW	10	127233821	missense	probably damaging	1.00
R6384:Kif5a	UTSW	10	127242775	missense	probably damaging	1.00
R6629:Kif5a	UTSW	10	127248254	missense	probably damaging	1.00
R7463:Kif5a	UTSW	10	127243724	missense	probably damaging	0.97
R7558:Kif5a	UTSW	10	127248079	missense	probably damaging	1.00
R7567:Kif5a	UTSW	10	127237379	missense	probably benign	0.00
R7733:Kif5a	UTSW	10	127236740	missense	probably benign	0.00
R7853:Kif5a	UTSW	10	127235668	nonsense	probably null
R7869:Kif5a	UTSW	10	127243474	missense	probably damaging	1.00
R7896:Kif5a	UTSW	10	127242004	missense	probably benign
R8085:Kif5a	UTSW	10	127239309	missense	probably benign	0.00
R8426:Kif5a	UTSW	10	127231489	missense	probably damaging	0.99
R8750:Kif5a	UTSW	10	127248040	missense	probably damaging	1.00
R9206:Kif5a	UTSW	10	127243358	critical splice donor site	probably null
R9497:Kif5a	UTSW	10	127243484	missense	probably damaging	1.00
R9747:Kif5a	UTSW	10	127238753	missense	probably benign	0.00
Z1177:Kif5a	UTSW	10	127229823	missense	probably benign	0.00
Z1177:Kif5a	UTSW	10	127236967	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AAATATTTGCTTATTACTGGGGAGGGC -3'
(R):5'- AACCGTCACGTAGCTGTCAC -3'

Sequencing Primer
(F):5'- ACTGGGGAGGGCTTGTAATATTATC -3'
(R):5'- TCACGTAGCTGTCACCAGTAAGTG -3'

Posted On

2014-09-17