Mutagenetix > Incidental Mutation

Incidental Mutation 'R2072:Stk3'

227265

Institutional Source

Beutler Lab

Gene Symbol

Stk3

Ensembl Gene

ENSMUSG00000022329

Gene Name

serine/threonine kinase 3

Synonyms

mess1, MST, Mst2

MMRRC Submission

040077-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2072 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34875496-35178921 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34959049 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 256 (M256V)

Ref Sequence

ENSEMBL: ENSMUSP00000064225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018476] [ENSMUST00000067033] [ENSMUST00000226555]

AlphaFold

Q9JI10

Predicted Effect

probably benign
Transcript: ENSMUST00000018476
AA Change: M326V

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000018476
Gene: ENSMUSG00000022329
AA Change: M326V

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
S_TKc	27	278	4.16e-103	SMART
low complexity region	301	324	N/A	INTRINSIC
low complexity region	370	381	N/A	INTRINSIC
Pfam:Mst1_SARAH	443	490	9.6e-28	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067033
AA Change: M256V

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000064225
Gene: ENSMUSG00000022329
AA Change: M256V

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	5	205	2.1e-41	PFAM
Pfam:Pkinase	5	208	1.2e-56	PFAM
coiled coil region	217	256	N/A	INTRINSIC
low complexity region	300	311	N/A	INTRINSIC
Pfam:Mst1_SARAH	372	420	9.8e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128425

Predicted Effect

probably benign
Transcript: ENSMUST00000226555
AA Change: M324V

PolyPhen 2 Score 0.377 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226730

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase activated by proapoptotic molecules indicating the encoded protein functions as a growth suppressor. Cleavage of the protein product by caspase removes the inhibitory C-terminal portion. The N-terminal portion is transported to the nucleus where it homodimerizes to form the active kinase which promotes the condensation of chromatin during apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous inactivation of this gene generally results in mice that are viable, fertile and developmentally normal. A small subset of mice homozygous for a knock-out allele develop mammary tumors in the absence of immunological defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	C	5: 63,898,737	R272P	possibly damaging	Het
9130011E15Rik	A	T	19: 45,965,381	I188K	probably damaging	Het
Ablim3	A	T	18: 61,857,088	D83E	possibly damaging	Het
Aco1	G	A	4: 40,183,605	G508S	probably damaging	Het
Adamts13	C	A	2: 27,005,425	T1176N	probably benign	Het
Adgre5	T	C	8: 83,727,804	T357A	probably benign	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Ankrd33	T	C	15: 101,119,636	V310A	probably benign	Het
Bnipl	C	T	3: 95,244,211	G232E	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Cacna1s	G	A	1: 136,079,504	V173I	probably benign	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chrdl1	T	C	X: 143,303,418	I231V	probably benign	Het
Ciita	C	T	16: 10,518,353	T958I	probably benign	Het
Cnot1	G	T	8: 95,739,833	T1592K	possibly damaging	Het
Dcaf15	T	C	8: 84,101,741	D240G	probably damaging	Het
Ddx58	A	T	4: 40,224,069		probably null	Het
Dlgap1	C	T	17: 70,662,770	R524C	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dsg1c	A	G	18: 20,275,252	M453V	probably benign	Het
Ednrb	G	T	14: 103,817,099	N432K	probably benign	Het
Fcgbp	G	A	7: 28,120,389	G2514S	probably damaging	Het
Fez1	A	G	9: 36,867,945	K306R	probably benign	Het
Fmo4	A	G	1: 162,809,887	V12A	probably benign	Het
Fpgt	T	C	3: 155,087,874	Y172C	probably damaging	Het
Fsip2	T	A	2: 83,008,815	F6976I	possibly damaging	Het
Galnt12	C	T	4: 47,108,477	R205*	probably null	Het
Grik5	A	T	7: 25,015,313	M752K	possibly damaging	Het
Herc2	A	G	7: 56,226,964	N4516S	probably damaging	Het
Ifrd2	A	T	9: 107,592,545	D439V	probably damaging	Het
Igsf3	A	G	3: 101,439,515	T609A	probably benign	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
Lgi2	A	G	5: 52,538,505	S371P	probably damaging	Het
March3	A	T	18: 56,811,853	V56E	possibly damaging	Het
Mib2	T	C	4: 155,659,701	D168G	probably damaging	Het
Nhs	T	A	X: 161,842,721	H544L	probably damaging	Het
Nlrp2	A	G	7: 5,325,006	S683P	probably damaging	Het
Olfr1260	C	A	2: 89,978,213	T145K	probably benign	Het
Olfr1454	A	T	19: 13,063,680	M90L	probably benign	Het
Olfr527	T	C	7: 140,336,653	S264P	possibly damaging	Het
Onecut3	T	G	10: 80,495,014	L3V	unknown	Het
Otogl	C	T	10: 107,781,043	C1791Y	probably damaging	Het
Paip1	T	C	13: 119,430,262	V128A	possibly damaging	Het
Pcnx2	A	T	8: 125,761,742	C1688S	possibly damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plxnb2	G	T	15: 89,158,451	R1545S	probably damaging	Het
Ppp4c	T	C	7: 126,787,348		probably null	Het
Prune1	C	T	3: 95,255,408	R318Q	probably benign	Het
Psg27	T	C	7: 18,560,417	D355G	probably damaging	Het
Psg27	A	G	7: 18,565,009	L129P	probably benign	Het
Psmc6	A	G	14: 45,329,866	K7E	possibly damaging	Het
Reln	A	T	5: 21,919,177	V2777E	probably damaging	Het
Scn11a	G	T	9: 119,811,208	A207E	possibly damaging	Het
Slc5a5	C	T	8: 70,892,439	G75R	possibly damaging	Het
Smarcd2	A	T	11: 106,265,307	L42*	probably null	Het
Smg1	T	C	7: 118,163,166		probably benign	Het
Smurf2	T	A	11: 106,841,769	Q335L	probably benign	Het
Sspo	A	T	6: 48,473,517	H2580L	probably benign	Het
Syt1	A	G	10: 108,583,972	I276T	probably damaging	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Taar9	A	T	10: 24,108,979	C186S	probably damaging	Het
Tnrc6b	C	T	15: 80,882,965	P977L	possibly damaging	Het
Trp53bp2	A	G	1: 182,458,867	T1091A	probably benign	Het
Ttn	G	T	2: 76,937,776	T2947N	probably damaging	Het
Ube2q1	T	C	3: 89,779,571		probably null	Het
Ube3c	A	G	5: 29,635,640	E671G	probably benign	Het
Upf3a	A	G	8: 13,785,850	K56R	possibly damaging	Het
Vmn2r15	A	T	5: 109,286,753	M695K	possibly damaging	Het
Vmn2r3	A	T	3: 64,275,072	M402K	possibly damaging	Het
Zfp354b	T	A	11: 50,922,452	R549*	probably null	Het
Zfp37	A	T	4: 62,191,708	M411K	probably damaging	Het
Zfp747	T	A	7: 127,373,970	T343S	possibly damaging	Het
Zfp853	T	A	5: 143,289,382	Q161L	unknown	Het

Other mutations in Stk3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00848:Stk3	APN	15	35114622	missense	possibly damaging	0.93
IGL02133:Stk3	APN	15	35099516	missense	probably damaging	1.00
IGL03121:Stk3	APN	15	35099426	splice site	probably benign
IGL03309:Stk3	APN	15	35099551	splice site	probably benign
R0276:Stk3	UTSW	15	35099469	missense	probably damaging	1.00
R0416:Stk3	UTSW	15	35114632	missense	probably benign	0.07
R1352:Stk3	UTSW	15	35008225	missense	probably damaging	1.00
R1633:Stk3	UTSW	15	34959060	missense	probably damaging	1.00
R1638:Stk3	UTSW	15	35008308	splice site	probably null
R1917:Stk3	UTSW	15	35073217	missense	probably damaging	1.00
R1919:Stk3	UTSW	15	35073217	missense	probably damaging	1.00
R2011:Stk3	UTSW	15	35072498	missense	probably damaging	1.00
R2073:Stk3	UTSW	15	34959049	missense	possibly damaging	0.79
R2075:Stk3	UTSW	15	34959049	missense	possibly damaging	0.79
R3158:Stk3	UTSW	15	35008241	missense	possibly damaging	0.83
R3402:Stk3	UTSW	15	34944998	splice site	probably benign
R4633:Stk3	UTSW	15	34958928	missense	probably damaging	0.99
R4672:Stk3	UTSW	15	35099457	missense	probably benign	0.06
R4687:Stk3	UTSW	15	35114565	missense	probably damaging	0.99
R4825:Stk3	UTSW	15	34999908	missense	probably benign	0.14
R4903:Stk3	UTSW	15	34959066	missense	probably damaging	0.99
R5390:Stk3	UTSW	15	35114560	nonsense	probably null
R5834:Stk3	UTSW	15	34959018	missense	probably damaging	1.00
R7208:Stk3	UTSW	15	35073116	missense	possibly damaging	0.76
R7266:Stk3	UTSW	15	34959036	missense	probably benign	0.05
R7862:Stk3	UTSW	15	35115586	missense	possibly damaging	0.90
R8354:Stk3	UTSW	15	34876724	missense	probably damaging	1.00
R8454:Stk3	UTSW	15	34876724	missense	probably damaging	1.00
R8996:Stk3	UTSW	15	34945062	missense	possibly damaging	0.51
R9160:Stk3	UTSW	15	35099465	missense	probably damaging	0.99
R9366:Stk3	UTSW	15	35072488	missense	probably damaging	1.00
R9777:Stk3	UTSW	15	35114645	missense	probably damaging	1.00
X0021:Stk3	UTSW	15	35072555	missense	probably damaging	1.00
X0060:Stk3	UTSW	15	35114533	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGAGAGAAAGGGCTCCATAC -3'
(R):5'- TCAGCTATCTTCAAGAGGTCTTTG -3'

Sequencing Primer
(F):5'- CAGAGAGAAAGGGCTCCATACTTTTC -3'
(R):5'- ACTTACCCAGAATTCTAGTTGCAAGG -3'

Posted On

2014-09-17