Mutagenetix > Incidental Mutation

Incidental Mutation 'R2072:Tnrc6b'

227267

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

040077-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R2072 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 80882965 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 977 (P977L)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067689
AA Change: P977L

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: P977L

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226857

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227546

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Predicted Effect

probably benign
Transcript: ENSMUST00000228124

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228320

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	G	C	5: 63,898,737	R272P	possibly damaging	Het
9130011E15Rik	A	T	19: 45,965,381	I188K	probably damaging	Het
Ablim3	A	T	18: 61,857,088	D83E	possibly damaging	Het
Aco1	G	A	4: 40,183,605	G508S	probably damaging	Het
Adamts13	C	A	2: 27,005,425	T1176N	probably benign	Het
Adgre5	T	C	8: 83,727,804	T357A	probably benign	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Ankrd33	T	C	15: 101,119,636	V310A	probably benign	Het
Bnipl	C	T	3: 95,244,211	G232E	probably damaging	Het
Btbd17	A	T	11: 114,791,952		probably null	Het
Cacna1s	G	A	1: 136,079,504	V173I	probably benign	Het
Ccdc122	T	C	14: 77,068,951		probably null	Het
Ces1a	T	A	8: 93,048,075	N12Y	probably benign	Het
Chrdl1	T	C	X: 143,303,418	I231V	probably benign	Het
Ciita	C	T	16: 10,518,353	T958I	probably benign	Het
Cnot1	G	T	8: 95,739,833	T1592K	possibly damaging	Het
Dcaf15	T	C	8: 84,101,741	D240G	probably damaging	Het
Ddx58	A	T	4: 40,224,069		probably null	Het
Dlgap1	C	T	17: 70,662,770	R524C	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dsg1c	A	G	18: 20,275,252	M453V	probably benign	Het
Ednrb	G	T	14: 103,817,099	N432K	probably benign	Het
Fcgbp	G	A	7: 28,120,389	G2514S	probably damaging	Het
Fez1	A	G	9: 36,867,945	K306R	probably benign	Het
Fmo4	A	G	1: 162,809,887	V12A	probably benign	Het
Fpgt	T	C	3: 155,087,874	Y172C	probably damaging	Het
Fsip2	T	A	2: 83,008,815	F6976I	possibly damaging	Het
Galnt12	C	T	4: 47,108,477	R205*	probably null	Het
Grik5	A	T	7: 25,015,313	M752K	possibly damaging	Het
Herc2	A	G	7: 56,226,964	N4516S	probably damaging	Het
Ifrd2	A	T	9: 107,592,545	D439V	probably damaging	Het
Igsf3	A	G	3: 101,439,515	T609A	probably benign	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
Lgi2	A	G	5: 52,538,505	S371P	probably damaging	Het
March3	A	T	18: 56,811,853	V56E	possibly damaging	Het
Mib2	T	C	4: 155,659,701	D168G	probably damaging	Het
Nhs	T	A	X: 161,842,721	H544L	probably damaging	Het
Nlrp2	A	G	7: 5,325,006	S683P	probably damaging	Het
Olfr1260	C	A	2: 89,978,213	T145K	probably benign	Het
Olfr1454	A	T	19: 13,063,680	M90L	probably benign	Het
Olfr527	T	C	7: 140,336,653	S264P	possibly damaging	Het
Onecut3	T	G	10: 80,495,014	L3V	unknown	Het
Otogl	C	T	10: 107,781,043	C1791Y	probably damaging	Het
Paip1	T	C	13: 119,430,262	V128A	possibly damaging	Het
Pcnx2	A	T	8: 125,761,742	C1688S	possibly damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phlpp2	T	C	8: 109,928,492	S605P	possibly damaging	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plxnb2	G	T	15: 89,158,451	R1545S	probably damaging	Het
Ppp4c	T	C	7: 126,787,348		probably null	Het
Prune1	C	T	3: 95,255,408	R318Q	probably benign	Het
Psg27	T	C	7: 18,560,417	D355G	probably damaging	Het
Psg27	A	G	7: 18,565,009	L129P	probably benign	Het
Psmc6	A	G	14: 45,329,866	K7E	possibly damaging	Het
Reln	A	T	5: 21,919,177	V2777E	probably damaging	Het
Scn11a	G	T	9: 119,811,208	A207E	possibly damaging	Het
Slc5a5	C	T	8: 70,892,439	G75R	possibly damaging	Het
Smarcd2	A	T	11: 106,265,307	L42*	probably null	Het
Smg1	T	C	7: 118,163,166		probably benign	Het
Smurf2	T	A	11: 106,841,769	Q335L	probably benign	Het
Sspo	A	T	6: 48,473,517	H2580L	probably benign	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Syt1	A	G	10: 108,583,972	I276T	probably damaging	Het
Syt10	C	T	15: 89,790,776	D456N	probably damaging	Het
Taar9	A	T	10: 24,108,979	C186S	probably damaging	Het
Trp53bp2	A	G	1: 182,458,867	T1091A	probably benign	Het
Ttn	G	T	2: 76,937,776	T2947N	probably damaging	Het
Ube2q1	T	C	3: 89,779,571		probably null	Het
Ube3c	A	G	5: 29,635,640	E671G	probably benign	Het
Upf3a	A	G	8: 13,785,850	K56R	possibly damaging	Het
Vmn2r15	A	T	5: 109,286,753	M695K	possibly damaging	Het
Vmn2r3	A	T	3: 64,275,072	M402K	possibly damaging	Het
Zfp354b	T	A	11: 50,922,452	R549*	probably null	Het
Zfp37	A	T	4: 62,191,708	M411K	probably damaging	Het
Zfp747	T	A	7: 127,373,970	T343S	possibly damaging	Het
Zfp853	T	A	5: 143,289,382	Q161L	unknown	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9450:Tnrc6b	UTSW	15	80880436	missense	probably benign	0.01
R9539:Tnrc6b	UTSW	15	80876343	missense	probably damaging	0.99
R9646:Tnrc6b	UTSW	15	80889065	missense	possibly damaging	0.89
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGTAGCACAGACAGTTCTTTTGC -3'
(R):5'- GCCTATGAGACAAGTTGCCAC -3'

Sequencing Primer
(F):5'- ACTGGGTCAGAAGTCATGTACATTG -3'
(R):5'- CTTGCAAACCAAGTCTACTTACTGG -3'

Posted On

2014-09-17