Incidental Mutation 'R2072:Dmd'
ID 227283
Institutional Source Beutler Lab
Gene Symbol Dmd
Ensembl Gene ENSMUSG00000045103
Gene Name dystrophin, muscular dystrophy
Synonyms Duchenne muscular dystrophy, pke, dys, Dp71, Dp427, X-linked muscular dystrophy, mdx
MMRRC Submission 040077-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.757) question?
Stock # R2072 (G1)
Quality Score 222
Status Not validated
Chromosome X
Chromosomal Location 81992476-84249747 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 83356089 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Proline at position 2257 (A2257P)
Ref Sequence ENSEMBL: ENSMUSP00000109633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114000]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114000
AA Change: A2257P

PolyPhen 2 Score 0.328 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109633
Gene: ENSMUSG00000045103
AA Change: A2257P

DomainStartEndE-ValueType
CH 17 117 5.94e-27 SMART
CH 136 235 3.83e-21 SMART
SPEC 344 448 7.39e-17 SMART
SPEC 453 557 6.49e-13 SMART
SPEC 564 668 9.73e-2 SMART
low complexity region 672 695 N/A INTRINSIC
SPEC 724 829 9.18e-13 SMART
SPEC 835 935 2.28e-1 SMART
SPEC 944 1046 9.34e-2 SMART
SPEC 1053 1155 7.99e-13 SMART
SPEC 1162 1264 7.52e-9 SMART
SPEC 1271 1368 5.53e-7 SMART
SPEC 1470 1569 7.29e-7 SMART
SPEC 1576 1677 8.29e-1 SMART
SPEC 1684 1781 1.82e-1 SMART
SPEC 1786 1875 3.48e0 SMART
SPEC 1882 1972 6.69e-2 SMART
SPEC 2000 2102 1.45e0 SMART
SPEC 2109 2209 6.15e-14 SMART
SPEC 2216 2317 8.9e-11 SMART
low complexity region 2325 2337 N/A INTRINSIC
low complexity region 2432 2444 N/A INTRINSIC
SPEC 2466 2569 1.65e-14 SMART
SPEC 2576 2678 1.2e-7 SMART
SPEC 2685 2794 9.84e-13 SMART
SPEC 2801 2923 8.38e-7 SMART
SPEC 2930 3032 1.21e-12 SMART
WW 3049 3081 1.36e-10 SMART
Pfam:EF-hand_2 3082 3200 1.7e-42 PFAM
Pfam:EF-hand_3 3204 3295 6.6e-41 PFAM
ZnF_ZZ 3300 3345 7.39e-18 SMART
coiled coil region 3488 3598 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139998
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a large, rod-like cytoskeletal protein which is found at the inner surface of muscle fibers in skeletal and cardiac muscles. The encoded protein, dystrophin, is part of the dystrophin-glycoprotein complex, which bridges the inner cytoskeleton (F-actin) and the extra-cellular matrix. This protein is required for proper development and organization of myofibers as contractile units in striated muscles. Mutations in the human gene cause Duchenne and Becker Muscular Dystrophies and a form of heart disease called DMD-associated dilated cardiomyopathy. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutations in this gene cause muscular dystrophy. Phenotypic variation has been observed in different backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G C 5: 64,056,080 (GRCm39) R272P possibly damaging Het
Ablim3 A T 18: 61,990,159 (GRCm39) D83E possibly damaging Het
Aco1 G A 4: 40,183,605 (GRCm39) G508S probably damaging Het
Adamts13 C A 2: 26,895,437 (GRCm39) T1176N probably benign Het
Adgre5 T C 8: 84,454,433 (GRCm39) T357A probably benign Het
Akap8l C T 17: 32,551,457 (GRCm39) R511H probably damaging Het
Ankrd33 T C 15: 101,017,517 (GRCm39) V310A probably benign Het
Armh3 A T 19: 45,953,820 (GRCm39) I188K probably damaging Het
Bnipl C T 3: 95,151,522 (GRCm39) G232E probably damaging Het
Btbd17 A T 11: 114,682,778 (GRCm39) probably null Het
Cacna1s G A 1: 136,007,242 (GRCm39) V173I probably benign Het
Ccdc122 T C 14: 77,306,391 (GRCm39) probably null Het
Ces1a T A 8: 93,774,703 (GRCm39) N12Y probably benign Het
Chrdl1 T C X: 142,086,414 (GRCm39) I231V probably benign Het
Ciita C T 16: 10,336,217 (GRCm39) T958I probably benign Het
Cnot1 G T 8: 96,466,461 (GRCm39) T1592K possibly damaging Het
Dcaf15 T C 8: 84,828,370 (GRCm39) D240G probably damaging Het
Dlgap1 C T 17: 70,969,765 (GRCm39) R524C probably damaging Het
Dsg1c A G 18: 20,408,309 (GRCm39) M453V probably benign Het
Ednrb G T 14: 104,054,535 (GRCm39) N432K probably benign Het
Fcgbp G A 7: 27,819,814 (GRCm39) G2514S probably damaging Het
Fez1 A G 9: 36,779,241 (GRCm39) K306R probably benign Het
Fmo4 A G 1: 162,637,456 (GRCm39) V12A probably benign Het
Fpgt T C 3: 154,793,511 (GRCm39) Y172C probably damaging Het
Fsip2 T A 2: 82,839,159 (GRCm39) F6976I possibly damaging Het
Galnt12 C T 4: 47,108,477 (GRCm39) R205* probably null Het
Grik5 A T 7: 24,714,738 (GRCm39) M752K possibly damaging Het
Herc2 A G 7: 55,876,712 (GRCm39) N4516S probably damaging Het
Ifrd2 A T 9: 107,469,744 (GRCm39) D439V probably damaging Het
Igsf3 A G 3: 101,346,831 (GRCm39) T609A probably benign Het
Kif5a T C 10: 127,081,238 (GRCm39) D232G probably damaging Het
Lgi2 A G 5: 52,695,847 (GRCm39) S371P probably damaging Het
Marchf3 A T 18: 56,944,925 (GRCm39) V56E possibly damaging Het
Mib2 T C 4: 155,744,158 (GRCm39) D168G probably damaging Het
Nhs T A X: 160,625,717 (GRCm39) H544L probably damaging Het
Nlrp2 A G 7: 5,328,005 (GRCm39) S683P probably damaging Het
Onecut3 T G 10: 80,330,848 (GRCm39) L3V unknown Het
Or12j2 T C 7: 139,916,566 (GRCm39) S264P possibly damaging Het
Or4c35 C A 2: 89,808,557 (GRCm39) T145K probably benign Het
Or5b102 A T 19: 13,041,044 (GRCm39) M90L probably benign Het
Otogl C T 10: 107,616,904 (GRCm39) C1791Y probably damaging Het
Paip1 T C 13: 119,566,798 (GRCm39) V128A possibly damaging Het
Pcnx2 A T 8: 126,488,481 (GRCm39) C1688S possibly damaging Het
Pdzd2 A G 15: 12,385,905 (GRCm39) L955P probably damaging Het
Phlpp2 T C 8: 110,655,124 (GRCm39) S605P possibly damaging Het
Pkhd1l1 G T 15: 44,422,035 (GRCm39) A3102S probably damaging Het
Plxnb2 G T 15: 89,042,654 (GRCm39) R1545S probably damaging Het
Ppp4c T C 7: 126,386,520 (GRCm39) probably null Het
Prune1 C T 3: 95,162,719 (GRCm39) R318Q probably benign Het
Psg27 T C 7: 18,294,342 (GRCm39) D355G probably damaging Het
Psg27 A G 7: 18,298,934 (GRCm39) L129P probably benign Het
Psmc6 A G 14: 45,567,323 (GRCm39) K7E possibly damaging Het
Reln A T 5: 22,124,175 (GRCm39) V2777E probably damaging Het
Rigi A T 4: 40,224,069 (GRCm39) probably null Het
Scn11a G T 9: 119,640,274 (GRCm39) A207E possibly damaging Het
Slc5a5 C T 8: 71,345,083 (GRCm39) G75R possibly damaging Het
Smarcd2 A T 11: 106,156,133 (GRCm39) L42* probably null Het
Smg1 T C 7: 117,762,389 (GRCm39) probably benign Het
Smurf2 T A 11: 106,732,595 (GRCm39) Q335L probably benign Het
Sspo A T 6: 48,450,451 (GRCm39) H2580L probably benign Het
Stk3 T C 15: 34,959,195 (GRCm39) M256V possibly damaging Het
Syt1 A G 10: 108,419,833 (GRCm39) I276T probably damaging Het
Syt10 C T 15: 89,674,979 (GRCm39) D456N probably damaging Het
Taar9 A T 10: 23,984,877 (GRCm39) C186S probably damaging Het
Tnrc6b C T 15: 80,767,166 (GRCm39) P977L possibly damaging Het
Trp53bp2 A G 1: 182,286,432 (GRCm39) T1091A probably benign Het
Ttn G T 2: 76,768,120 (GRCm39) T2947N probably damaging Het
Ube2q1 T C 3: 89,686,878 (GRCm39) probably null Het
Ube3c A G 5: 29,840,638 (GRCm39) E671G probably benign Het
Upf3a A G 8: 13,835,850 (GRCm39) K56R possibly damaging Het
Vmn2r15 A T 5: 109,434,619 (GRCm39) M695K possibly damaging Het
Vmn2r3 A T 3: 64,182,493 (GRCm39) M402K possibly damaging Het
Zfp354b T A 11: 50,813,279 (GRCm39) R549* probably null Het
Zfp37 A T 4: 62,109,945 (GRCm39) M411K probably damaging Het
Zfp747 T A 7: 126,973,142 (GRCm39) T343S possibly damaging Het
Zfp853 T A 5: 143,275,137 (GRCm39) Q161L unknown Het
Other mutations in Dmd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Dmd APN X 82,951,978 (GRCm39) splice site probably null
IGL00823:Dmd APN X 83,469,419 (GRCm39) splice site probably null
IGL01160:Dmd APN X 82,968,567 (GRCm39) missense probably damaging 1.00
IGL01285:Dmd APN X 84,153,590 (GRCm39) nonsense probably null
IGL01294:Dmd APN X 83,475,604 (GRCm39) splice site probably null
IGL02426:Dmd APN X 83,892,342 (GRCm39) missense probably damaging 1.00
IGL02610:Dmd APN X 82,707,762 (GRCm39) missense probably damaging 1.00
IGL02887:Dmd APN X 82,922,110 (GRCm39) missense probably benign 0.44
IGL03268:Dmd APN X 82,849,814 (GRCm39) missense probably damaging 0.98
IGL03301:Dmd APN X 82,952,120 (GRCm39) missense probably damaging 1.00
R0480:Dmd UTSW X 83,469,344 (GRCm39) missense probably benign 0.00
R0714:Dmd UTSW X 83,353,503 (GRCm39) missense probably benign 0.00
R1296:Dmd UTSW X 82,922,126 (GRCm39) missense probably damaging 1.00
R1448:Dmd UTSW X 83,892,306 (GRCm39) missense probably damaging 0.97
R1678:Dmd UTSW X 84,018,368 (GRCm39) missense probably benign 0.43
R1714:Dmd UTSW X 83,008,356 (GRCm39) missense probably benign 0.17
R1951:Dmd UTSW X 82,874,123 (GRCm39) missense probably damaging 1.00
R1952:Dmd UTSW X 82,874,123 (GRCm39) missense probably damaging 1.00
R1953:Dmd UTSW X 82,874,123 (GRCm39) missense probably damaging 1.00
R1955:Dmd UTSW X 82,922,163 (GRCm39) missense probably benign 0.10
R2073:Dmd UTSW X 83,356,089 (GRCm39) missense probably benign 0.33
R2074:Dmd UTSW X 83,356,089 (GRCm39) missense probably benign 0.33
R2075:Dmd UTSW X 83,356,089 (GRCm39) missense probably benign 0.33
R2118:Dmd UTSW X 83,356,089 (GRCm39) missense probably benign 0.33
R2119:Dmd UTSW X 83,356,089 (GRCm39) missense probably benign 0.33
R2120:Dmd UTSW X 83,356,089 (GRCm39) missense probably benign 0.33
R2122:Dmd UTSW X 83,356,089 (GRCm39) missense probably benign 0.33
R4398:Dmd UTSW X 82,765,624 (GRCm39) missense probably benign 0.01
X0025:Dmd UTSW X 83,690,800 (GRCm39) missense probably benign
Z1088:Dmd UTSW X 83,619,366 (GRCm39) missense probably benign 0.05
Z1088:Dmd UTSW X 82,922,101 (GRCm39) missense possibly damaging 0.67
Z1176:Dmd UTSW X 82,922,090 (GRCm39) missense possibly damaging 0.90
Z1176:Dmd UTSW X 82,670,892 (GRCm39) missense probably damaging 1.00
Z1177:Dmd UTSW X 82,670,877 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGCCCATCAGCTCTGTG -3'
(R):5'- AAGAATAATCCACCCTTCTGCTTC -3'

Sequencing Primer
(F):5'- GCTCTGTGCTCTGTGGAAG -3'
(R):5'- GTTGCAACACTTAGCACATGTGAC -3'
Posted On 2014-09-17