Mutagenetix > Incidental Mutations

Incidental Mutation 'R2073:Sec16a'

227294

Institutional Source

Beutler Lab

Gene Symbol

Sec16a

Ensembl Gene

ENSMUSG00000026924

Gene Name

SEC16 homolog A, endoplasmic reticulum export factor

Synonyms

C230052J16Rik

MMRRC Submission

040078-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R2073 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26409431-26445216 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26440239 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 588 (I588T)

Ref Sequence

ENSEMBL: ENSMUSP00000109716 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091252] [ENSMUST00000114082]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091252
AA Change: I588T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000088796
Gene: ENSMUSG00000026924
AA Change: I588T

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1463	1565	3.1e-24	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1635	1898	2.3e-39	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114082
AA Change: I588T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109716
Gene: ENSMUSG00000026924
AA Change: I588T

Domain	Start	End	E-Value	Type
low complexity region	2	21	N/A	INTRINSIC
low complexity region	204	221	N/A	INTRINSIC
low complexity region	243	254	N/A	INTRINSIC
low complexity region	371	382	N/A	INTRINSIC
low complexity region	537	561	N/A	INTRINSIC
low complexity region	608	621	N/A	INTRINSIC
low complexity region	760	777	N/A	INTRINSIC
low complexity region	1096	1105	N/A	INTRINSIC
low complexity region	1134	1150	N/A	INTRINSIC
low complexity region	1185	1195	N/A	INTRINSIC
low complexity region	1370	1392	N/A	INTRINSIC
Pfam:Sec16	1464	1564	2.6e-10	PFAM
low complexity region	1600	1614	N/A	INTRINSIC
Pfam:Sec16_C	1636	1887	6.8e-45	PFAM
low complexity region	2109	2124	N/A	INTRINSIC
low complexity region	2165	2177	N/A	INTRINSIC
low complexity region	2187	2197	N/A	INTRINSIC
low complexity region	2227	2242	N/A	INTRINSIC
low complexity region	2310	2320	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153996

SMART Domains

Protein: ENSMUSP00000121179
Gene: ENSMUSG00000026924

Domain	Start	End	E-Value	Type
low complexity region	12	29	N/A	INTRINSIC
low complexity region	116	125	N/A	INTRINSIC
low complexity region	154	170	N/A	INTRINSIC
low complexity region	205	215	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155252

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that forms part of the Sec16 complex. This protein has a role in protein transport from the endoplasmic reticulum (ER) to the Golgi and mediates COPII vesicle formation at the transitional ER. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Feb 2013]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	A	G	4: 41,507,519		probably null	Het
2310057M21Rik	T	C	7: 131,357,513	R153G	probably benign	Het
4930430A15Rik	T	C	2: 111,200,418	E382G	probably damaging	Het
5730596B20Rik	C	A	6: 52,178,982	Y9*	probably null	Het
9130011E15Rik	A	T	19: 45,965,381	I188K	probably damaging	Het
Aco1	G	A	4: 40,183,605	G508S	probably damaging	Het
Acot3	A	G	12: 84,053,456	H2R	possibly damaging	Het
Adamts13	T	A	2: 27,006,314	C1240S	probably damaging	Het
Adra1b	T	C	11: 43,835,871	N73S	probably damaging	Het
Aebp2	G	A	6: 140,633,694	S219N	probably benign	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Ank	T	C	15: 27,565,022	S270P	probably benign	Het
Ankle1	G	A	8: 71,409,329	R492H	possibly damaging	Het
Ankub1	G	A	3: 57,692,292	H19Y	possibly damaging	Het
Anln	C	A	9: 22,333,168	W1083L	probably benign	Het
Apaf1	G	T	10: 91,031,694	S763*	probably null	Het
Apba3	A	G	10: 81,269,294	T134A	probably benign	Het
Bod1l	C	T	5: 41,819,189	S1594N	probably benign	Het
C7	T	C	15: 4,990,428	M746V	probably benign	Het
Cdkn2a	T	A	4: 89,294,493	I11F	possibly damaging	Het
Cideb	T	C	14: 55,755,160	M100V	possibly damaging	Het
Cntnap5c	T	C	17: 58,305,552	L862P	possibly damaging	Het
Coch	A	T	12: 51,602,689	D261V	probably benign	Het
Cyp2ab1	A	G	16: 20,313,889	F220L	possibly damaging	Het
Ddx10	A	T	9: 53,240,505	D73E	probably benign	Het
Dgkg	A	G	16: 22,565,317	F462S	probably damaging	Het
Dlgap3	C	T	4: 127,195,366	H252Y	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dtnb	A	G	12: 3,781,273	T658A	probably benign	Het
Duox2	T	A	2: 122,295,158	S323C	probably damaging	Het
Dync1h1	T	A	12: 110,614,592	I251N	probably damaging	Het
Eml5	A	G	12: 98,802,446	S1457P	probably damaging	Het
Fam114a1	T	A	5: 64,995,904		probably null	Het
Fcho1	A	T	8: 71,710,489	L632Q	probably damaging	Het
Gm12695	T	C	4: 96,723,945	Y527C	possibly damaging	Het
Gm16223	T	C	5: 42,214,599	C111R	unknown	Het
H2-Q4	T	A	17: 35,380,402	S154T	possibly damaging	Het
Hhat	A	G	1: 192,727,379	F125L	possibly damaging	Het
Ier5l	T	A	2: 30,473,056	D319V	probably damaging	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
M1ap	A	G	6: 82,981,882	I165V	probably benign	Het
Map2k4	A	C	11: 65,693,456	F334V	probably damaging	Het
Mmp19	G	A	10: 128,794,979	R156H	probably damaging	Het
Mpped2	T	A	2: 106,744,802	Y77*	probably null	Het
Nhs	T	A	X: 161,842,721	H544L	probably damaging	Het
Nr4a1	C	A	15: 101,274,067	H541N	probably damaging	Het
Olfr1247	A	G	2: 89,609,478	V208A	probably benign	Het
Olfr1484	A	T	19: 13,585,601	Q99L	probably damaging	Het
Pak6	A	C	2: 118,688,851	N17T	probably damaging	Het
Pcnt	T	A	10: 76,380,380	T2225S	possibly damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phf21a	A	G	2: 92,348,036	D357G	probably damaging	Het
Pih1d3	A	G	1: 31,222,996	S20G	probably benign	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plch2	A	T	4: 154,989,909	L754Q	probably damaging	Het
Plekhd1	A	G	12: 80,721,292	N335D	probably benign	Het
Pole	C	A	5: 110,325,551	T1737N	probably damaging	Het
Pramel6	G	A	2: 87,508,744	S96N	probably damaging	Het
Prdm14	A	C	1: 13,125,730	Y36D	possibly damaging	Het
Psg27	T	C	7: 18,560,417	D355G	probably damaging	Het
Rfc1	A	T	5: 65,301,939	D225E	probably damaging	Het
Setd6	G	A	8: 95,716,788	V60M	probably damaging	Het
Sgk3	A	G	1: 9,891,424	I432V	probably benign	Het
Six2	A	G	17: 85,687,505	S150P	probably damaging	Het
Slc1a6	T	C	10: 78,800,130	V343A	possibly damaging	Het
Slc43a3	T	C	2: 84,944,612		probably null	Het
Smc3	A	G	19: 53,631,533	D620G	probably benign	Het
Smg6	C	G	11: 74,930,294	P464A	probably damaging	Het
Sox11	T	C	12: 27,342,279	T44A	possibly damaging	Het
Spata22	A	G	11: 73,336,226	R89G	possibly damaging	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Syne2	A	G	12: 76,015,579	D4226G	possibly damaging	Het
Tecpr2	T	C	12: 110,968,429	S1370P	possibly damaging	Het
Tek	A	G	4: 94,827,729	I463V	probably benign	Het
Trib1	T	A	15: 59,654,340	I253N	probably damaging	Het
Triobp	G	T	15: 78,973,895	G1232V	probably damaging	Het
Trpm6	G	A	19: 18,876,042	V1809M	probably damaging	Het
Tsc22d4	A	G	5: 137,762,487	K57E	possibly damaging	Het
Vmn2r109	T	A	17: 20,564,712	K15N	probably benign	Het
Wdr78	G	A	4: 103,050,193	T632M	probably damaging	Het
Wnt9a	A	G	11: 59,331,229	N318D	probably damaging	Het
Wwp1	A	G	4: 19,662,181	V138A	possibly damaging	Het
Zfp37	A	T	4: 62,191,708	M411K	probably damaging	Het
Zfp715	T	A	7: 43,311,120	T16S	probably benign	Het
Zfp932	A	G	5: 110,009,818	T461A	possibly damaging	Het
Zscan29	A	T	2: 121,160,855	C817*	probably null	Het

Other mutations in Sec16a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Sec16a	APN	2	26439487	missense	probably benign	0.15
IGL00435:Sec16a	APN	2	26430101	missense	probably benign	0.00
IGL00469:Sec16a	APN	2	26428300	missense	probably damaging	1.00
IGL01622:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL01623:Sec16a	APN	2	26438903	missense	probably benign	0.00
IGL02158:Sec16a	APN	2	26416632	critical splice donor site	probably null
IGL02188:Sec16a	APN	2	26436008	missense	probably damaging	1.00
IGL02445:Sec16a	APN	2	26422040	missense	probably benign
IGL02568:Sec16a	APN	2	26436042	missense	probably damaging	1.00
IGL02710:Sec16a	APN	2	26430130	missense	possibly damaging	0.75
IGL02735:Sec16a	APN	2	26428137	splice site	probably benign
IGL02964:Sec16a	APN	2	26419723	missense	probably benign	0.00
IGL03027:Sec16a	APN	2	26423589	missense	probably benign	0.13
IGL03073:Sec16a	APN	2	26439183	missense	probably benign	0.02
IGL03297:Sec16a	APN	2	26439190	missense	probably benign	0.05
IGL03339:Sec16a	APN	2	26435933	missense	probably benign
H8562:Sec16a	UTSW	2	26441505	missense	probably benign
IGL03050:Sec16a	UTSW	2	26415747	missense	probably damaging	1.00
PIT4486001:Sec16a	UTSW	2	26425773	missense
R0039:Sec16a	UTSW	2	26423914	missense	probably benign	0.03
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0095:Sec16a	UTSW	2	26425760	splice site	probably null
R0189:Sec16a	UTSW	2	26424414	splice site	probably null
R0255:Sec16a	UTSW	2	26431186	missense	probably damaging	0.97
R0278:Sec16a	UTSW	2	26428316	missense	probably damaging	1.00
R0739:Sec16a	UTSW	2	26441051	missense	possibly damaging	0.94
R0743:Sec16a	UTSW	2	26419722	missense	possibly damaging	0.67
R1446:Sec16a	UTSW	2	26423567	missense	probably benign	0.00
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1466:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1501:Sec16a	UTSW	2	26440045	missense	probably benign	0.16
R1524:Sec16a	UTSW	2	26428382	missense	probably damaging	1.00
R1584:Sec16a	UTSW	2	26431157	missense	probably damaging	0.98
R1649:Sec16a	UTSW	2	26425524	missense	probably damaging	1.00
R1744:Sec16a	UTSW	2	26439186	missense	probably damaging	1.00
R1959:Sec16a	UTSW	2	26430132	missense	probably benign	0.00
R1973:Sec16a	UTSW	2	26426489	missense	probably damaging	1.00
R2005:Sec16a	UTSW	2	26439080	missense	probably benign	0.27
R2074:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2075:Sec16a	UTSW	2	26440239	missense	probably damaging	1.00
R2151:Sec16a	UTSW	2	26413745	intron	probably benign
R2472:Sec16a	UTSW	2	26439936	missense	probably damaging	1.00
R2512:Sec16a	UTSW	2	26439025	missense	probably benign	0.00
R2520:Sec16a	UTSW	2	26441356	nonsense	probably null
R2571:Sec16a	UTSW	2	26439331	missense	probably benign	0.08
R3105:Sec16a	UTSW	2	26438421	missense	probably benign	0.14
R3508:Sec16a	UTSW	2	26425850	missense	probably damaging	1.00
R3809:Sec16a	UTSW	2	26441813	missense	possibly damaging	0.71
R3912:Sec16a	UTSW	2	26414387	missense	probably damaging	0.97
R4292:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4293:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4294:Sec16a	UTSW	2	26422155	missense	probably benign	0.01
R4576:Sec16a	UTSW	2	26431119	nonsense	probably null
R4611:Sec16a	UTSW	2	26441805	missense	probably benign	0.04
R4627:Sec16a	UTSW	2	26429393	missense	probably damaging	1.00
R4627:Sec16a	UTSW	2	26431068	unclassified	probably null
R4662:Sec16a	UTSW	2	26430570	missense	probably damaging	1.00
R4665:Sec16a	UTSW	2	26412958	intron	probably benign
R4906:Sec16a	UTSW	2	26441967	unclassified	probably benign
R4967:Sec16a	UTSW	2	26412871	missense	probably benign	0.00
R4983:Sec16a	UTSW	2	26439519	missense	probably benign
R5033:Sec16a	UTSW	2	26419649	missense	probably benign	0.00
R5251:Sec16a	UTSW	2	26439345	missense	probably benign	0.00
R5391:Sec16a	UTSW	2	26440032	missense	possibly damaging	0.82
R5457:Sec16a	UTSW	2	26440268	missense	probably benign	0.01
R5530:Sec16a	UTSW	2	26439252	missense	probably benign	0.00
R5645:Sec16a	UTSW	2	26439895	missense	probably benign	0.01
R5661:Sec16a	UTSW	2	26439637	missense	probably benign	0.01
R5770:Sec16a	UTSW	2	26414390	missense	probably damaging	0.99
R5830:Sec16a	UTSW	2	26440841	missense	probably benign	0.15
R5866:Sec16a	UTSW	2	26419638	missense	probably benign	0.00
R5875:Sec16a	UTSW	2	26433367	missense	probably damaging	1.00
R5906:Sec16a	UTSW	2	26438831	missense	possibly damaging	0.63
R5922:Sec16a	UTSW	2	26415639	missense	probably benign	0.05
R6076:Sec16a	UTSW	2	26423942	missense	probably damaging	1.00
R6091:Sec16a	UTSW	2	26426470	missense	probably damaging	1.00
R6295:Sec16a	UTSW	2	26428241	missense	probably damaging	1.00
R6302:Sec16a	UTSW	2	26425805	missense	probably damaging	1.00
R6309:Sec16a	UTSW	2	26438571	missense	probably benign	0.00
R6459:Sec16a	UTSW	2	26423500	missense	probably benign	0.04
R6520:Sec16a	UTSW	2	26426106	missense	probably damaging	1.00
R6631:Sec16a	UTSW	2	26439957	missense	probably damaging	1.00
R6657:Sec16a	UTSW	2	26425864	nonsense	probably null
R6750:Sec16a	UTSW	2	26440018	missense	probably benign	0.00
R6852:Sec16a	UTSW	2	26441419	missense	probably damaging	0.99
R6860:Sec16a	UTSW	2	26430112	missense	probably damaging	1.00
R6967:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6968:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6970:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6991:Sec16a	UTSW	2	26430486	missense	probably damaging	1.00
R6993:Sec16a	UTSW	2	26423574	missense	probably damaging	0.99
R7009:Sec16a	UTSW	2	26436002	nonsense	probably null
R7057:Sec16a	UTSW	2	26425265	missense	probably damaging	1.00
R7186:Sec16a	UTSW	2	26440703	nonsense	probably null
R7227:Sec16a	UTSW	2	26438923	missense	probably benign	0.01
R7234:Sec16a	UTSW	2	26439768	missense	probably damaging	1.00
R7259:Sec16a	UTSW	2	26441592	missense	probably benign	0.00
R7326:Sec16a	UTSW	2	26439717	missense	unknown
R7371:Sec16a	UTSW	2	26441722	missense	probably benign
R7388:Sec16a	UTSW	2	26428364	missense
R7414:Sec16a	UTSW	2	26423631	missense
R7417:Sec16a	UTSW	2	26421397	missense
R7501:Sec16a	UTSW	2	26441851	missense	probably damaging	1.00
R7558:Sec16a	UTSW	2	26439734	missense
R7696:Sec16a	UTSW	2	26415633	critical splice donor site	probably null
X0011:Sec16a	UTSW	2	26415643	missense	probably damaging	1.00
X0034:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
X0062:Sec16a	UTSW	2	26416697	missense	probably benign	0.07
Z1088:Sec16a	UTSW	2	26439093	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- ACAGTATTGGGTCCCTCTCAC -3'
(R):5'- GCTAAATCTTGAGGCCCCAG -3'

Sequencing Primer
(F):5'- ACCATGTTGGCACGATCTG -3'
(R):5'- TCTTGAGGCCCCAGACACAC -3'

Posted On

2014-09-17