Incidental Mutation 'R2073:Adamts13'
ID227295
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
MMRRC Submission 040078-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2073 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 27006314 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 1240 (C1240S)
Ref Sequence ENSEMBL: ENSMUSP00000099955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102891] [ENSMUST00000114003] [ENSMUST00000114004] [ENSMUST00000114005] [ENSMUST00000114006] [ENSMUST00000114007]
Predicted Effect probably damaging
Transcript: ENSMUST00000102891
AA Change: C1240S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: C1240S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000114003
SMART Domains Protein: ENSMUSP00000109636
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
Cg6151-P 1 80 6.19e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114004
SMART Domains Protein: ENSMUSP00000109637
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 106 7.88e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114005
SMART Domains Protein: ENSMUSP00000109638
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 114 5.53e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114006
SMART Domains Protein: ENSMUSP00000109639
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114007
SMART Domains Protein: ENSMUSP00000109640
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 5 17 N/A INTRINSIC
Cg6151-P 33 142 2.87e-61 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133126
Predicted Effect probably benign
Transcript: ENSMUST00000133807
SMART Domains Protein: ENSMUSP00000122562
Gene: ENSMUSG00000015488

DomainStartEndE-ValueType
low complexity region 29 42 N/A INTRINSIC
Cg6151-P 53 118 8.02e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147216
Meta Mutation Damage Score 0.8718 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,507,519 probably null Het
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dlgap3 C T 4: 127,195,366 H252Y probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Map2k4 A C 11: 65,693,456 F334V probably damaging Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Setd6 G A 8: 95,716,788 V60M probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Vmn2r109 T A 17: 20,564,712 K15N probably benign Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp715 T A 7: 43,311,120 T16S probably benign Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL02837:Adamts13 UTSW 2 26991420 missense probably benign 0.01
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0276:Adamts13 UTSW 2 26975760 missense possibly damaging 0.91
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0369:Adamts13 UTSW 2 27005186 missense probably benign 0.00
R0386:Adamts13 UTSW 2 26986679 splice site probably null
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R0862:Adamts13 UTSW 2 27006324 critical splice donor site probably null
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5126:Adamts13 UTSW 2 26996915 critical splice donor site probably null
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5660:Adamts13 UTSW 2 26996749 missense probably benign
R5890:Adamts13 UTSW 2 26986591 missense probably damaging 0.96
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R6929:Adamts13 UTSW 2 27006263 nonsense probably null
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R7392:Adamts13 UTSW 2 26989324 missense probably damaging 1.00
R7583:Adamts13 UTSW 2 26973953 missense probably benign
R7604:Adamts13 UTSW 2 27005206 missense probably benign 0.00
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCCTACTTACTCTGTTCTGG -3'
(R):5'- GGGCTGAGTTCCAATTACCAC -3'

Sequencing Primer
(F):5'- GTTCTGGCCACCTCACC -3'
(R):5'- CCCTCTTACTGGCTAATGTGACAAAG -3'
Posted On2014-09-17