Incidental Mutation 'R2073:Aco1'
ID227311
Institutional Source Beutler Lab
Gene Symbol Aco1
Ensembl Gene ENSMUSG00000028405
Gene Nameaconitase 1
SynonymsIrp1, Irebp, Aco-1
MMRRC Submission 040078-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.458) question?
Stock #R2073 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location40143081-40198338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40183605 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 508 (G508S)
Ref Sequence ENSEMBL: ENSMUSP00000100038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102973]
Predicted Effect probably damaging
Transcript: ENSMUST00000102973
AA Change: G508S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100038
Gene: ENSMUSG00000028405
AA Change: G508S

DomainStartEndE-ValueType
Pfam:Aconitase 54 564 4.5e-180 PFAM
Pfam:Aconitase_C 692 821 1e-48 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the aconitase/IPM isomerase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. Depending on iron levels in the cytosol, the encoded protein can function as either an aconitase enzyme or as an mRNA binding protein. When cellular iron levels are high, the encoded protein functions as an aconitase, an essential enzyme in the TCA cycle that catalyzes the conversion of citrate to isocitrate. When cellular iron levels are low, the encoded protein regulates iron uptake and utilization by binding to iron-responsive elements in the untranslated regions of mRNAs for genes involved in iron metabolism. Disruption of this gene is associated with pulmonary hypertension and polycythemia. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display no obvious phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,507,519 probably null Het
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dlgap3 C T 4: 127,195,366 H252Y probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Map2k4 A C 11: 65,693,456 F334V probably damaging Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Setd6 G A 8: 95,716,788 V60M probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Vmn2r109 T A 17: 20,564,712 K15N probably benign Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp715 T A 7: 43,311,120 T16S probably benign Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in Aco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Aco1 APN 4 40180290 critical splice donor site probably null
IGL01081:Aco1 APN 4 40197576 missense probably benign
IGL01364:Aco1 APN 4 40181380 splice site probably null
IGL01733:Aco1 APN 4 40175738 splice site probably benign
IGL02232:Aco1 APN 4 40175996 missense probably damaging 1.00
IGL02709:Aco1 APN 4 40180199 missense possibly damaging 0.86
IGL03164:Aco1 APN 4 40167116 missense probably benign 0.30
IGL03208:Aco1 APN 4 40186424 missense possibly damaging 0.55
IGL03324:Aco1 APN 4 40186363 missense probably benign
IGL03353:Aco1 APN 4 40175893 missense probably damaging 0.99
R0002:Aco1 UTSW 4 40176649 splice site probably benign
R0486:Aco1 UTSW 4 40177783 missense probably damaging 1.00
R0636:Aco1 UTSW 4 40175697 missense probably damaging 1.00
R1344:Aco1 UTSW 4 40179008 missense probably damaging 1.00
R1844:Aco1 UTSW 4 40197566 missense probably benign 0.00
R1889:Aco1 UTSW 4 40164607 critical splice acceptor site probably null
R1932:Aco1 UTSW 4 40176499 missense probably damaging 1.00
R1959:Aco1 UTSW 4 40167193 critical splice donor site probably null
R1965:Aco1 UTSW 4 40175730 missense probably damaging 1.00
R1983:Aco1 UTSW 4 40175845 missense probably benign 0.37
R2072:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R2074:Aco1 UTSW 4 40183605 missense probably damaging 1.00
R3155:Aco1 UTSW 4 40182915 missense probably damaging 1.00
R4595:Aco1 UTSW 4 40167139 missense probably benign 0.43
R4999:Aco1 UTSW 4 40176507 missense probably damaging 1.00
R5131:Aco1 UTSW 4 40163797 missense probably benign
R5354:Aco1 UTSW 4 40180290 critical splice donor site probably null
R5380:Aco1 UTSW 4 40177848 missense probably damaging 1.00
R6352:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6353:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6380:Aco1 UTSW 4 40185028 missense probably benign 0.02
R6540:Aco1 UTSW 4 40186367 missense probably benign 0.10
R6751:Aco1 UTSW 4 40188330 intron probably null
R6760:Aco1 UTSW 4 40180210 nonsense probably null
R6833:Aco1 UTSW 4 40164747 missense probably benign 0.00
R6834:Aco1 UTSW 4 40164747 missense probably benign 0.00
R7019:Aco1 UTSW 4 40186376 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCAACTCCTGTGTTAACAAGC -3'
(R):5'- AGCACTCTCTAAAACTCTGCTATAG -3'

Sequencing Primer
(F):5'- GCTTTAAAATGTCAGTAGCATCCTG -3'
(R):5'- TTAGCTGCCCGACGTTACACAG -3'
Posted On2014-09-17