Mutagenetix > Incidental Mutation

Incidental Mutation 'R2073:Cdkn2a'

227314

Institutional Source

Beutler Lab

Gene Symbol

Cdkn2a

Ensembl Gene

ENSMUSG00000044303

Gene Name

cyclin dependent kinase inhibitor 2A

Synonyms

p16, Ink4a/Arf, MTS1, p19ARF, p16INK4a, p19, Pctr1, Arf, INK4a-ARF, ARF-INK4a

MMRRC Submission

040078-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2073 (G1)

Quality Score

189

Status

Not validated

Chromosome

Chromosomal Location

89192710-89212856 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89212730 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 11 (I11F)

Ref Sequence

ENSEMBL: ENSMUSP00000102748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000107131]

AlphaFold

Q64364

PDB Structure

SOLUTION STRUCTURE OF THE N-TERMINAL 37 AMINO ACIDS OF THE MOUSE ARF TUMOR SUPPRESSOR PROTEIN [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000030237
AA Change: I11F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000030237
Gene: ENSMUSG00000044303
AA Change: I11F

Domain	Start	End	E-Value	Type
Pfam:P19Arf_N	4	54	4.6e-26	PFAM
low complexity region	70	76	N/A	INTRINSIC
low complexity region	105	121	N/A	INTRINSIC
transmembrane domain	142	159	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107131
AA Change: I11F

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000102748
Gene: ENSMUSG00000044303
AA Change: I11F

Domain	Start	End	E-Value	Type
Blast:ANK	1	21	2e-6	BLAST
ANK	26	55	2.8e0	SMART
ANK	59	88	6.3e-1	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]
PHENOTYPE: Null mutants of p16INK4a or p19ARF proteins each show increased tumor susceptibility and sensitivity to carcinogens. Loss of both gives very early onset. p19ARF nulls also show thymic hyperplasia and the eye's hyaloid vascular system fails to regress. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310057M21Rik	T	C	7: 130,959,242 (GRCm39)	R153G	probably benign	Het
5730596B20Rik	C	A	6: 52,155,962 (GRCm39)	Y9*	probably null	Het
Aco1	G	A	4: 40,183,605 (GRCm39)	G508S	probably damaging	Het
Acot3	A	G	12: 84,100,230 (GRCm39)	H2R	possibly damaging	Het
Adamts13	T	A	2: 26,896,326 (GRCm39)	C1240S	probably damaging	Het
Adra1b	T	C	11: 43,726,698 (GRCm39)	N73S	probably damaging	Het
Aebp2	G	A	6: 140,579,420 (GRCm39)	S219N	probably benign	Het
Akap8l	C	T	17: 32,551,457 (GRCm39)	R511H	probably damaging	Het
Ank	T	C	15: 27,565,108 (GRCm39)	S270P	probably benign	Het
Ankle1	G	A	8: 71,861,973 (GRCm39)	R492H	possibly damaging	Het
Ankub1	G	A	3: 57,599,713 (GRCm39)	H19Y	possibly damaging	Het
Anln	C	A	9: 22,244,464 (GRCm39)	W1083L	probably benign	Het
Apaf1	G	T	10: 90,867,556 (GRCm39)	S763*	probably null	Het
Apba3	A	G	10: 81,105,128 (GRCm39)	T134A	probably benign	Het
Armh3	A	T	19: 45,953,820 (GRCm39)	I188K	probably damaging	Het
Bod1l	C	T	5: 41,976,532 (GRCm39)	S1594N	probably benign	Het
C7	T	C	15: 5,019,910 (GRCm39)	M746V	probably benign	Het
Cideb	T	C	14: 55,992,617 (GRCm39)	M100V	possibly damaging	Het
Cntnap5c	T	C	17: 58,612,547 (GRCm39)	L862P	possibly damaging	Het
Coch	A	T	12: 51,649,472 (GRCm39)	D261V	probably benign	Het
Cyp2ab1	A	G	16: 20,132,639 (GRCm39)	F220L	possibly damaging	Het
Ddx10	A	T	9: 53,151,805 (GRCm39)	D73E	probably benign	Het
Dgkg	A	G	16: 22,384,067 (GRCm39)	F462S	probably damaging	Het
Dlgap3	C	T	4: 127,089,159 (GRCm39)	H252Y	probably damaging	Het
Dmd	G	C	X: 83,356,089 (GRCm39)	A2257P	probably benign	Het
Dnaaf6rt	A	G	1: 31,262,077 (GRCm39)	S20G	probably benign	Het
Dnai4	G	A	4: 102,907,390 (GRCm39)	T632M	probably damaging	Het
Dtnb	A	G	12: 3,831,273 (GRCm39)	T658A	probably benign	Het
Duox2	T	A	2: 122,125,639 (GRCm39)	S323C	probably damaging	Het
Dync1h1	T	A	12: 110,581,026 (GRCm39)	I251N	probably damaging	Het
Eml5	A	G	12: 98,768,705 (GRCm39)	S1457P	probably damaging	Het
Fam114a1	T	A	5: 65,153,247 (GRCm39)		probably null	Het
Fcho1	A	T	8: 72,163,133 (GRCm39)	L632Q	probably damaging	Het
Gm12695	T	C	4: 96,612,182 (GRCm39)	Y527C	possibly damaging	Het
Gm16223	T	C	5: 42,371,942 (GRCm39)	C111R	unknown	Het
H2-Q4	T	A	17: 35,599,378 (GRCm39)	S154T	possibly damaging	Het
Hhat	A	G	1: 192,409,687 (GRCm39)	F125L	possibly damaging	Het
Ier5l	T	A	2: 30,363,068 (GRCm39)	D319V	probably damaging	Het
Kif5a	T	C	10: 127,081,238 (GRCm39)	D232G	probably damaging	Het
M1ap	A	G	6: 82,958,863 (GRCm39)	I165V	probably benign	Het
Map2k4	A	C	11: 65,584,282 (GRCm39)	F334V	probably damaging	Het
Mmp19	G	A	10: 128,630,848 (GRCm39)	R156H	probably damaging	Het
Mpped2	T	A	2: 106,575,147 (GRCm39)	Y77*	probably null	Het
Nhs	T	A	X: 160,625,717 (GRCm39)	H544L	probably damaging	Het
Nr4a1	C	A	15: 101,171,948 (GRCm39)	H541N	probably damaging	Het
Or4a74	A	G	2: 89,439,822 (GRCm39)	V208A	probably benign	Het
Or5b122	A	T	19: 13,562,965 (GRCm39)	Q99L	probably damaging	Het
Pak6	A	C	2: 118,519,332 (GRCm39)	N17T	probably damaging	Het
Pcnt	T	A	10: 76,216,214 (GRCm39)	T2225S	possibly damaging	Het
Pdzd2	A	G	15: 12,385,905 (GRCm39)	L955P	probably damaging	Het
Phf21a	A	G	2: 92,178,381 (GRCm39)	D357G	probably damaging	Het
Pkhd1l1	G	T	15: 44,422,035 (GRCm39)	A3102S	probably damaging	Het
Plch2	A	T	4: 155,074,366 (GRCm39)	L754Q	probably damaging	Het
Plekhd1	A	G	12: 80,768,066 (GRCm39)	N335D	probably benign	Het
Pole	C	A	5: 110,473,417 (GRCm39)	T1737N	probably damaging	Het
Potefam1	T	C	2: 111,030,763 (GRCm39)	E382G	probably damaging	Het
Pramel6	G	A	2: 87,339,088 (GRCm39)	S96N	probably damaging	Het
Prdm14	A	C	1: 13,195,954 (GRCm39)	Y36D	possibly damaging	Het
Psg27	T	C	7: 18,294,342 (GRCm39)	D355G	probably damaging	Het
Rfc1	A	T	5: 65,459,282 (GRCm39)	D225E	probably damaging	Het
Sec16a	A	G	2: 26,330,251 (GRCm39)	I588T	probably damaging	Het
Setd6	G	A	8: 96,443,416 (GRCm39)	V60M	probably damaging	Het
Sgk3	A	G	1: 9,961,649 (GRCm39)	I432V	probably benign	Het
Six2	A	G	17: 85,994,933 (GRCm39)	S150P	probably damaging	Het
Slc1a6	T	C	10: 78,635,964 (GRCm39)	V343A	possibly damaging	Het
Slc43a3	T	C	2: 84,774,956 (GRCm39)		probably null	Het
Smc3	A	G	19: 53,619,964 (GRCm39)	D620G	probably benign	Het
Smg6	C	G	11: 74,821,120 (GRCm39)	P464A	probably damaging	Het
Sox11	T	C	12: 27,392,278 (GRCm39)	T44A	possibly damaging	Het
Spata22	A	G	11: 73,227,052 (GRCm39)	R89G	possibly damaging	Het
Spmip6	A	G	4: 41,507,519 (GRCm39)		probably null	Het
Stk3	T	C	15: 34,959,195 (GRCm39)	M256V	possibly damaging	Het
Syne2	A	G	12: 76,062,353 (GRCm39)	D4226G	possibly damaging	Het
Tecpr2	T	C	12: 110,934,863 (GRCm39)	S1370P	possibly damaging	Het
Tek	A	G	4: 94,715,966 (GRCm39)	I463V	probably benign	Het
Trib1	T	A	15: 59,526,189 (GRCm39)	I253N	probably damaging	Het
Triobp	G	T	15: 78,858,095 (GRCm39)	G1232V	probably damaging	Het
Trpm6	G	A	19: 18,853,406 (GRCm39)	V1809M	probably damaging	Het
Tsc22d4	A	G	5: 137,760,749 (GRCm39)	K57E	possibly damaging	Het
Vmn2r109	T	A	17: 20,784,974 (GRCm39)	K15N	probably benign	Het
Wnt9a	A	G	11: 59,222,055 (GRCm39)	N318D	probably damaging	Het
Wwp1	A	G	4: 19,662,181 (GRCm39)	V138A	possibly damaging	Het
Zfp37	A	T	4: 62,109,945 (GRCm39)	M411K	probably damaging	Het
Zfp715	T	A	7: 42,960,544 (GRCm39)	T16S	probably benign	Het
Zfp932	A	G	5: 110,157,684 (GRCm39)	T461A	possibly damaging	Het
Zscan29	A	T	2: 120,991,336 (GRCm39)	C817*	probably null	Het

Other mutations in Cdkn2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01936:Cdkn2a	APN	4	89,212,569 (GRCm39)	critical splice donor site	probably null	0.00
R0158:Cdkn2a	UTSW	4	89,195,004 (GRCm39)	missense	possibly damaging	0.92
R4787:Cdkn2a	UTSW	4	89,194,955 (GRCm39)	missense	unknown
R5679:Cdkn2a	UTSW	4	89,195,098 (GRCm39)	missense	possibly damaging	0.88
R6863:Cdkn2a	UTSW	4	89,193,003 (GRCm39)	missense	probably benign
R8344:Cdkn2a	UTSW	4	89,194,987 (GRCm39)	missense	probably benign	0.17
R8348:Cdkn2a	UTSW	4	89,200,291 (GRCm39)	missense	possibly damaging	0.58
R8448:Cdkn2a	UTSW	4	89,200,291 (GRCm39)	missense	possibly damaging	0.58
R8490:Cdkn2a	UTSW	4	89,212,759 (GRCm39)	start codon destroyed	probably null	0.02

Predicted Primers

PCR Primer
(F):5'- TCCATCTCCCGGGAACTAAG -3'
(R):5'- ACCCGAAAGTTAACCGGAG -3'

Sequencing Primer
(F):5'- TCCCGGGAACTAAGCCGAAG -3'
(R):5'- CGCCTCTGGGAAGCTTTC -3'

Posted On

2014-09-17