Incidental Mutation 'R2073:Dlgap3'
ID227318
Institutional Source Beutler Lab
Gene Symbol Dlgap3
Ensembl Gene ENSMUSG00000042388
Gene NameDLG associated protein 3
SynonymsPSD-95/SAP90-binding protein 3, SAP90/PSD 95 associated protein 3, Sapap3, DAP3, Prpl8
MMRRC Submission 040078-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2073 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127169204-127237022 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127195366 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 252 (H252Y)
Ref Sequence ENSEMBL: ENSMUSP00000101700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046659] [ENSMUST00000106092] [ENSMUST00000106094]
Predicted Effect probably damaging
Transcript: ENSMUST00000046659
AA Change: H252Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039724
Gene: ENSMUSG00000042388
AA Change: H252Y

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 977 1.3e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106092
AA Change: H252Y

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101698
Gene: ENSMUSG00000042388
AA Change: H252Y

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 5.59e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 5.59e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 619 966 1.8e-127 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106094
AA Change: H252Y

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101700
Gene: ENSMUSG00000042388
AA Change: H252Y

DomainStartEndE-ValueType
low complexity region 53 88 N/A INTRINSIC
low complexity region 145 159 N/A INTRINSIC
low complexity region 200 243 N/A INTRINSIC
low complexity region 258 284 N/A INTRINSIC
low complexity region 338 354 N/A INTRINSIC
internal_repeat_1 387 411 6.49e-5 PROSPERO
low complexity region 419 429 N/A INTRINSIC
internal_repeat_1 493 517 6.49e-5 PROSPERO
low complexity region 539 550 N/A INTRINSIC
low complexity region 597 615 N/A INTRINSIC
Pfam:GKAP 626 977 1.3e-149 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit skin lesions associated with excessive grooming, increased anxiety-related behaviors, altered synaptic transmission and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,507,519 probably null Het
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Map2k4 A C 11: 65,693,456 F334V probably damaging Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Setd6 G A 8: 95,716,788 V60M probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Vmn2r109 T A 17: 20,564,712 K15N probably benign Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp715 T A 7: 43,311,120 T16S probably benign Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in Dlgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Dlgap3 APN 4 127233897 missense probably benign 0.01
IGL03122:Dlgap3 APN 4 127195225 missense possibly damaging 0.86
IGL03259:Dlgap3 APN 4 127200284 missense probably benign 0.05
Compulsive UTSW 4 127195709 nonsense probably null
R0363:Dlgap3 UTSW 4 127235521 missense probably damaging 1.00
R1222:Dlgap3 UTSW 4 127194613 start codon destroyed probably null 0.01
R1386:Dlgap3 UTSW 4 127194926 missense possibly damaging 0.81
R1603:Dlgap3 UTSW 4 127195228 missense probably damaging 1.00
R2119:Dlgap3 UTSW 4 127236189 missense probably benign
R2696:Dlgap3 UTSW 4 127194623 missense probably damaging 1.00
R3076:Dlgap3 UTSW 4 127195706 missense probably damaging 1.00
R3738:Dlgap3 UTSW 4 127195606 missense probably damaging 0.99
R4344:Dlgap3 UTSW 4 127214348 missense possibly damaging 0.84
R4676:Dlgap3 UTSW 4 127233761 missense probably damaging 0.99
R4720:Dlgap3 UTSW 4 127195715 critical splice donor site probably null
R4893:Dlgap3 UTSW 4 127194983 missense probably damaging 1.00
R5384:Dlgap3 UTSW 4 127236330 missense probably damaging 1.00
R5841:Dlgap3 UTSW 4 127195400 missense probably damaging 1.00
R5870:Dlgap3 UTSW 4 127195709 nonsense probably null
R6379:Dlgap3 UTSW 4 127234974 missense probably damaging 1.00
R7028:Dlgap3 UTSW 4 127195517 missense possibly damaging 0.74
R7454:Dlgap3 UTSW 4 127235059 missense probably null 0.01
R7479:Dlgap3 UTSW 4 127194625 missense possibly damaging 0.72
R8104:Dlgap3 UTSW 4 127236154 missense probably damaging 0.99
X0024:Dlgap3 UTSW 4 127236172 missense probably damaging 1.00
Z1177:Dlgap3 UTSW 4 127194984 missense probably damaging 0.99
Z1177:Dlgap3 UTSW 4 127235498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACTATAACGGGCCCAAGG -3'
(R):5'- GCACTTCGCTTGACTGACTGTC -3'

Sequencing Primer
(F):5'- GCCGACGGAAGAGGTAGCTC -3'
(R):5'- TTGACTGACTGTCCATCCAGGG -3'
Posted On2014-09-17