Mutagenetix > Incidental Mutations

Incidental Mutation 'R2073:Plch2'

227319

Institutional Source

Beutler Lab

Gene Symbol

Plch2

Ensembl Gene

ENSMUSG00000029055

Gene Name

phospholipase C, eta 2

Synonyms

Plcl4, A930027K05Rik, PLCeta2

MMRRC Submission

040078-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2073 (G1)

Quality Score

101

Status

Not validated

Chromosome

Chromosomal Location

154983115-155056784 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 154989909 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 754 (L754Q)

Ref Sequence

ENSEMBL: ENSMUSP00000118292 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105631] [ENSMUST00000135665] [ENSMUST00000139976] [ENSMUST00000176194] [ENSMUST00000186598]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105631
AA Change: L859Q

PolyPhen 2 Score 0.694 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101256
Gene: ENSMUSG00000029055
AA Change: L859Q

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	1.7e-26	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1088	1107	N/A	INTRINSIC
low complexity region	1227	1236	N/A	INTRINSIC
low complexity region	1356	1369	N/A	INTRINSIC
low complexity region	1421	1451	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124517

SMART Domains

Protein: ENSMUSP00000122139
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
C2	1	77	1.58e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127661

Predicted Effect

probably damaging
Transcript: ENSMUST00000135665
AA Change: L754Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000118292
Gene: ENSMUSG00000029055
AA Change: L754Q

Domain	Start	End	E-Value	Type
PH	17	126	1.8e-6	SMART
EFh	142	170	7.29e-4	SMART
EFh	178	207	4.67e-2	SMART
Pfam:EF-hand_like	212	294	2.8e-25	PFAM
PLCXc	295	440	6.76e-76	SMART
low complexity region	454	467	N/A	INTRINSIC
low complexity region	554	571	N/A	INTRINSIC
PLCYc	602	716	1.25e-56	SMART
C2	735	843	1.66e-21	SMART
low complexity region	983	1002	N/A	INTRINSIC
low complexity region	1122	1131	N/A	INTRINSIC
low complexity region	1251	1264	N/A	INTRINSIC
low complexity region	1316	1346	N/A	INTRINSIC
low complexity region	1349	1361	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000139976
AA Change: L859Q

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000122704
Gene: ENSMUSG00000029055
AA Change: L859Q

Domain	Start	End	E-Value	Type
low complexity region	28	45	N/A	INTRINSIC
low complexity region	96	107	N/A	INTRINSIC
PH	122	231	1.8e-6	SMART
EFh	247	275	7.29e-4	SMART
EFh	283	312	4.67e-2	SMART
Pfam:EF-hand_like	317	399	3.2e-27	PFAM
PLCXc	400	545	6.76e-76	SMART
low complexity region	559	572	N/A	INTRINSIC
low complexity region	659	676	N/A	INTRINSIC
PLCYc	707	821	1.25e-56	SMART
C2	840	948	1.66e-21	SMART
low complexity region	1087	1100	N/A	INTRINSIC
low complexity region	1166	1194	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000175982
AA Change: L607Q

Predicted Effect

probably damaging
Transcript: ENSMUST00000176194
AA Change: L758Q

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000134750
Gene: ENSMUSG00000029055
AA Change: L758Q

Domain	Start	End	E-Value	Type
PH	21	130	1.8e-6	SMART
EFh	146	174	7.29e-4	SMART
EFh	182	211	4.67e-2	SMART
Pfam:EF-hand_like	216	298	1.6e-25	PFAM
PLCXc	299	444	6.76e-76	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	558	575	N/A	INTRINSIC
PLCYc	606	720	1.25e-56	SMART
C2	739	847	1.66e-21	SMART
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1065	1093	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176620

Predicted Effect

probably benign
Transcript: ENSMUST00000186598

SMART Domains

Protein: ENSMUSP00000141152
Gene: ENSMUSG00000029055

Domain	Start	End	E-Value	Type
C2	79	189	5.8e-18	SMART
low complexity region	328	341	N/A	INTRINSIC
low complexity region	407	435	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH2 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave PtdIns(4,5) P2 to generate second messengers inositol 1,4,5-trisphosphate and diacylglycerol (Zhou et al., 2005 [PubMed 16107206]).[supplied by OMIM, Jun 2009]
PHENOTYPE: Mice homozygous for a reporter allele exhibit no apparent abnormal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110017D15Rik	A	G	4: 41,507,519		probably null	Het
2310057M21Rik	T	C	7: 131,357,513	R153G	probably benign	Het
4930430A15Rik	T	C	2: 111,200,418	E382G	probably damaging	Het
5730596B20Rik	C	A	6: 52,178,982	Y9*	probably null	Het
9130011E15Rik	A	T	19: 45,965,381	I188K	probably damaging	Het
Aco1	G	A	4: 40,183,605	G508S	probably damaging	Het
Acot3	A	G	12: 84,053,456	H2R	possibly damaging	Het
Adamts13	T	A	2: 27,006,314	C1240S	probably damaging	Het
Adra1b	T	C	11: 43,835,871	N73S	probably damaging	Het
Aebp2	G	A	6: 140,633,694	S219N	probably benign	Het
Akap8l	C	T	17: 32,332,483	R511H	probably damaging	Het
Ank	T	C	15: 27,565,022	S270P	probably benign	Het
Ankle1	G	A	8: 71,409,329	R492H	possibly damaging	Het
Ankub1	G	A	3: 57,692,292	H19Y	possibly damaging	Het
Anln	C	A	9: 22,333,168	W1083L	probably benign	Het
Apaf1	G	T	10: 91,031,694	S763*	probably null	Het
Apba3	A	G	10: 81,269,294	T134A	probably benign	Het
Bod1l	C	T	5: 41,819,189	S1594N	probably benign	Het
C7	T	C	15: 4,990,428	M746V	probably benign	Het
Cdkn2a	T	A	4: 89,294,493	I11F	possibly damaging	Het
Cideb	T	C	14: 55,755,160	M100V	possibly damaging	Het
Cntnap5c	T	C	17: 58,305,552	L862P	possibly damaging	Het
Coch	A	T	12: 51,602,689	D261V	probably benign	Het
Cyp2ab1	A	G	16: 20,313,889	F220L	possibly damaging	Het
Ddx10	A	T	9: 53,240,505	D73E	probably benign	Het
Dgkg	A	G	16: 22,565,317	F462S	probably damaging	Het
Dlgap3	C	T	4: 127,195,366	H252Y	probably damaging	Het
Dmd	G	C	X: 84,312,483	A2257P	probably benign	Het
Dtnb	A	G	12: 3,781,273	T658A	probably benign	Het
Duox2	T	A	2: 122,295,158	S323C	probably damaging	Het
Dync1h1	T	A	12: 110,614,592	I251N	probably damaging	Het
Eml5	A	G	12: 98,802,446	S1457P	probably damaging	Het
Fam114a1	T	A	5: 64,995,904		probably null	Het
Fcho1	A	T	8: 71,710,489	L632Q	probably damaging	Het
Gm12695	T	C	4: 96,723,945	Y527C	possibly damaging	Het
Gm16223	T	C	5: 42,214,599	C111R	unknown	Het
H2-Q4	T	A	17: 35,380,402	S154T	possibly damaging	Het
Hhat	A	G	1: 192,727,379	F125L	possibly damaging	Het
Ier5l	T	A	2: 30,473,056	D319V	probably damaging	Het
Kif5a	T	C	10: 127,245,369	D232G	probably damaging	Het
M1ap	A	G	6: 82,981,882	I165V	probably benign	Het
Map2k4	A	C	11: 65,693,456	F334V	probably damaging	Het
Mmp19	G	A	10: 128,794,979	R156H	probably damaging	Het
Mpped2	T	A	2: 106,744,802	Y77*	probably null	Het
Nhs	T	A	X: 161,842,721	H544L	probably damaging	Het
Nr4a1	C	A	15: 101,274,067	H541N	probably damaging	Het
Olfr1247	A	G	2: 89,609,478	V208A	probably benign	Het
Olfr1484	A	T	19: 13,585,601	Q99L	probably damaging	Het
Pak6	A	C	2: 118,688,851	N17T	probably damaging	Het
Pcnt	T	A	10: 76,380,380	T2225S	possibly damaging	Het
Pdzd2	A	G	15: 12,385,819	L955P	probably damaging	Het
Phf21a	A	G	2: 92,348,036	D357G	probably damaging	Het
Pih1d3	A	G	1: 31,222,996	S20G	probably benign	Het
Pkhd1l1	G	T	15: 44,558,639	A3102S	probably damaging	Het
Plekhd1	A	G	12: 80,721,292	N335D	probably benign	Het
Pole	C	A	5: 110,325,551	T1737N	probably damaging	Het
Pramel6	G	A	2: 87,508,744	S96N	probably damaging	Het
Prdm14	A	C	1: 13,125,730	Y36D	possibly damaging	Het
Psg27	T	C	7: 18,560,417	D355G	probably damaging	Het
Rfc1	A	T	5: 65,301,939	D225E	probably damaging	Het
Sec16a	A	G	2: 26,440,239	I588T	probably damaging	Het
Setd6	G	A	8: 95,716,788	V60M	probably damaging	Het
Sgk3	A	G	1: 9,891,424	I432V	probably benign	Het
Six2	A	G	17: 85,687,505	S150P	probably damaging	Het
Slc1a6	T	C	10: 78,800,130	V343A	possibly damaging	Het
Slc43a3	T	C	2: 84,944,612		probably null	Het
Smc3	A	G	19: 53,631,533	D620G	probably benign	Het
Smg6	C	G	11: 74,930,294	P464A	probably damaging	Het
Sox11	T	C	12: 27,342,279	T44A	possibly damaging	Het
Spata22	A	G	11: 73,336,226	R89G	possibly damaging	Het
Stk3	T	C	15: 34,959,049	M256V	possibly damaging	Het
Syne2	A	G	12: 76,015,579	D4226G	possibly damaging	Het
Tecpr2	T	C	12: 110,968,429	S1370P	possibly damaging	Het
Tek	A	G	4: 94,827,729	I463V	probably benign	Het
Trib1	T	A	15: 59,654,340	I253N	probably damaging	Het
Triobp	G	T	15: 78,973,895	G1232V	probably damaging	Het
Trpm6	G	A	19: 18,876,042	V1809M	probably damaging	Het
Tsc22d4	A	G	5: 137,762,487	K57E	possibly damaging	Het
Vmn2r109	T	A	17: 20,564,712	K15N	probably benign	Het
Wdr78	G	A	4: 103,050,193	T632M	probably damaging	Het
Wnt9a	A	G	11: 59,331,229	N318D	probably damaging	Het
Wwp1	A	G	4: 19,662,181	V138A	possibly damaging	Het
Zfp37	A	T	4: 62,191,708	M411K	probably damaging	Het
Zfp715	T	A	7: 43,311,120	T16S	probably benign	Het
Zfp932	A	G	5: 110,009,818	T461A	possibly damaging	Het
Zscan29	A	T	2: 121,160,855	C817*	probably null	Het

Other mutations in Plch2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Plch2	APN	4	155006642	missense	probably damaging	1.00
IGL02024:Plch2	APN	4	155043138	intron	probably benign
IGL02580:Plch2	APN	4	154984764	missense	probably benign	0.03
IGL03370:Plch2	APN	4	154986914	missense	probably benign	0.18
IGL03407:Plch2	APN	4	154989798	missense	probably damaging	1.00
tolerant	UTSW	4	154984635	missense	probably benign	0.01
PIT4418001:Plch2	UTSW	4	154989503	missense	probably damaging	1.00
PIT4445001:Plch2	UTSW	4	155009026	missense	probably damaging	1.00
R0117:Plch2	UTSW	4	154985358	unclassified	probably benign
R0347:Plch2	UTSW	4	154986721	missense	possibly damaging	0.91
R0361:Plch2	UTSW	4	155006711	missense	possibly damaging	0.95
R0413:Plch2	UTSW	4	155006916	critical splice donor site	probably null
R0487:Plch2	UTSW	4	155009012	missense	probably damaging	1.00
R0514:Plch2	UTSW	4	154998886	missense	probably damaging	1.00
R0734:Plch2	UTSW	4	154996283	missense	probably damaging	1.00
R0766:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1306:Plch2	UTSW	4	155007140	missense	probably damaging	1.00
R1312:Plch2	UTSW	4	154989799	missense	probably damaging	1.00
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1467:Plch2	UTSW	4	154983732	missense	probably benign	0.02
R1602:Plch2	UTSW	4	154984450	missense	probably damaging	0.99
R1717:Plch2	UTSW	4	154998272	missense	probably benign
R1731:Plch2	UTSW	4	155006994	missense	possibly damaging	0.83
R1769:Plch2	UTSW	4	155000083	missense	probably damaging	1.00
R1875:Plch2	UTSW	4	154998508	missense	probably damaging	1.00
R1974:Plch2	UTSW	4	154984953	missense	possibly damaging	0.77
R2031:Plch2	UTSW	4	155043027	intron	probably benign
R2050:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R2061:Plch2	UTSW	4	155042841	intron	probably benign
R2075:Plch2	UTSW	4	154989909	missense	probably damaging	1.00
R2109:Plch2	UTSW	4	154984597	missense	possibly damaging	0.92
R2126:Plch2	UTSW	4	154998999	missense	probably damaging	1.00
R2265:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2266:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2269:Plch2	UTSW	4	154993004	missense	probably benign	0.06
R2280:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2281:Plch2	UTSW	4	154984309	missense	probably damaging	1.00
R2432:Plch2	UTSW	4	154986164	makesense	probably null
R2971:Plch2	UTSW	4	154990767	missense	probably benign	0.29
R3437:Plch2	UTSW	4	154991013	critical splice donor site	probably null
R3980:Plch2	UTSW	4	154984798	missense	probably benign	0.00
R4757:Plch2	UTSW	4	154996233	missense	possibly damaging	0.88
R4827:Plch2	UTSW	4	154991113	missense	probably damaging	1.00
R4828:Plch2	UTSW	4	154984635	missense	probably benign	0.01
R4869:Plch2	UTSW	4	154989428	missense	probably benign	0.28
R5020:Plch2	UTSW	4	155007083	missense	probably damaging	1.00
R5050:Plch2	UTSW	4	155043309	intron	probably benign
R5126:Plch2	UTSW	4	155000519	missense	probably damaging	1.00
R5237:Plch2	UTSW	4	155010794	missense	probably benign
R5274:Plch2	UTSW	4	154998954	missense	probably damaging	1.00
R5296:Plch2	UTSW	4	154989999	splice site	probably null
R5324:Plch2	UTSW	4	154984534	missense	probably benign
R5475:Plch2	UTSW	4	155000137	missense	probably damaging	1.00
R5494:Plch2	UTSW	4	154991122	missense	probably damaging	1.00
R5811:Plch2	UTSW	4	154992567	missense	possibly damaging	0.62
R6083:Plch2	UTSW	4	155000818	missense	probably benign	0.00
R6092:Plch2	UTSW	4	154984372	missense	probably benign	0.02
R6253:Plch2	UTSW	4	155007101	missense	probably damaging	1.00
R6456:Plch2	UTSW	4	154993002	missense	probably damaging	1.00
R7038:Plch2	UTSW	4	154990032	splice site	probably null
R7084:Plch2	UTSW	4	154986991	missense	probably benign	0.31
R7210:Plch2	UTSW	4	155009086	missense	probably damaging	1.00
R7216:Plch2	UTSW	4	154984228	missense	probably benign
R7264:Plch2	UTSW	4	154998967	missense	probably damaging	0.98
R7291:Plch2	UTSW	4	154998472	missense	probably damaging	1.00
R7423:Plch2	UTSW	4	154983737	missense	probably damaging	1.00
R7436:Plch2	UTSW	4	154984096	missense	probably benign	0.01
R7438:Plch2	UTSW	4	155000460	missense	probably damaging	1.00
R7594:Plch2	UTSW	4	155007027	missense	probably damaging	1.00
R7663:Plch2	UTSW	4	154991162	missense	probably damaging	0.96
R7698:Plch2	UTSW	4	155002787	missense	possibly damaging	0.95
R7844:Plch2	UTSW	4	154989465	missense	probably damaging	1.00
R7939:Plch2	UTSW	4	155002778	missense	possibly damaging	0.91
R8003:Plch2	UTSW	4	155054523	missense	unknown
R8007:Plch2	UTSW	4	155002831	missense	probably damaging	1.00
R8281:Plch2	UTSW	4	155006973	missense	probably benign	0.07
R8434:Plch2	UTSW	4	154989735	missense	probably damaging	1.00
R8504:Plch2	UTSW	4	154984395	missense	probably benign	0.31
R8516:Plch2	UTSW	4	154986307	missense	probably benign
RF014:Plch2	UTSW	4	155007120	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAAGCCCTCACCCACTTTG -3'
(R):5'- CAAAGCTTTCTGACCCTTCCCTAAG -3'

Sequencing Primer
(F):5'- TCACCCACTTTGGCGGGAG -3'
(R):5'- CCTAAGGCTCTTTTTCACCAGAG -3'

Posted On

2014-09-17