Incidental Mutation 'R2073:Map2k4'
ID227349
Institutional Source Beutler Lab
Gene Symbol Map2k4
Ensembl Gene ENSMUSG00000033352
Gene Namemitogen-activated protein kinase kinase 4
SynonymsSerk1, MKK4, Sek1, JNKK1
MMRRC Submission 040078-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2073 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65688243-65788297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65693456 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 334 (F334V)
Ref Sequence ENSEMBL: ENSMUSP00000041282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046963] [ENSMUST00000125598] [ENSMUST00000140301]
Predicted Effect probably damaging
Transcript: ENSMUST00000046963
AA Change: F334V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041282
Gene: ENSMUSG00000033352
AA Change: F334V

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
S_TKc 100 365 9.38e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125598
SMART Domains Protein: ENSMUSP00000137656
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
Pfam:Pkinase 34 128 8.4e-27 PFAM
Pfam:Kinase-like 36 128 8.9e-8 PFAM
Pfam:Pkinase_Tyr 37 129 6.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140301
SMART Domains Protein: ENSMUSP00000137955
Gene: ENSMUSG00000033352

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140740
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mitogen-activated protein kinase (MAPK) family. Members of this family act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation, and development. They form a three-tiered signaling module composed of MAPKKKs, MAPKKs, and MAPKs. This protein is phosphorylated at serine and threonine residues by MAPKKKs and subsequently phosphorylates downstream MAPK targets at threonine and tyrosine residues. A similar protein in mouse has been reported to play a role in liver organogenesis. A pseudogene of this gene is located on the long arm of chromosome X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormal liver development with a deficiency of parenchymal hepatocytes, severe anemia, and lethality before embryonic day 14.0. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik A G 4: 41,507,519 probably null Het
2310057M21Rik T C 7: 131,357,513 R153G probably benign Het
4930430A15Rik T C 2: 111,200,418 E382G probably damaging Het
5730596B20Rik C A 6: 52,178,982 Y9* probably null Het
9130011E15Rik A T 19: 45,965,381 I188K probably damaging Het
Aco1 G A 4: 40,183,605 G508S probably damaging Het
Acot3 A G 12: 84,053,456 H2R possibly damaging Het
Adamts13 T A 2: 27,006,314 C1240S probably damaging Het
Adra1b T C 11: 43,835,871 N73S probably damaging Het
Aebp2 G A 6: 140,633,694 S219N probably benign Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Ank T C 15: 27,565,022 S270P probably benign Het
Ankle1 G A 8: 71,409,329 R492H possibly damaging Het
Ankub1 G A 3: 57,692,292 H19Y possibly damaging Het
Anln C A 9: 22,333,168 W1083L probably benign Het
Apaf1 G T 10: 91,031,694 S763* probably null Het
Apba3 A G 10: 81,269,294 T134A probably benign Het
Bod1l C T 5: 41,819,189 S1594N probably benign Het
C7 T C 15: 4,990,428 M746V probably benign Het
Cdkn2a T A 4: 89,294,493 I11F possibly damaging Het
Cideb T C 14: 55,755,160 M100V possibly damaging Het
Cntnap5c T C 17: 58,305,552 L862P possibly damaging Het
Coch A T 12: 51,602,689 D261V probably benign Het
Cyp2ab1 A G 16: 20,313,889 F220L possibly damaging Het
Ddx10 A T 9: 53,240,505 D73E probably benign Het
Dgkg A G 16: 22,565,317 F462S probably damaging Het
Dlgap3 C T 4: 127,195,366 H252Y probably damaging Het
Dmd G C X: 84,312,483 A2257P probably benign Het
Dtnb A G 12: 3,781,273 T658A probably benign Het
Duox2 T A 2: 122,295,158 S323C probably damaging Het
Dync1h1 T A 12: 110,614,592 I251N probably damaging Het
Eml5 A G 12: 98,802,446 S1457P probably damaging Het
Fam114a1 T A 5: 64,995,904 probably null Het
Fcho1 A T 8: 71,710,489 L632Q probably damaging Het
Gm12695 T C 4: 96,723,945 Y527C possibly damaging Het
Gm16223 T C 5: 42,214,599 C111R unknown Het
H2-Q4 T A 17: 35,380,402 S154T possibly damaging Het
Hhat A G 1: 192,727,379 F125L possibly damaging Het
Ier5l T A 2: 30,473,056 D319V probably damaging Het
Kif5a T C 10: 127,245,369 D232G probably damaging Het
M1ap A G 6: 82,981,882 I165V probably benign Het
Mmp19 G A 10: 128,794,979 R156H probably damaging Het
Mpped2 T A 2: 106,744,802 Y77* probably null Het
Nhs T A X: 161,842,721 H544L probably damaging Het
Nr4a1 C A 15: 101,274,067 H541N probably damaging Het
Olfr1247 A G 2: 89,609,478 V208A probably benign Het
Olfr1484 A T 19: 13,585,601 Q99L probably damaging Het
Pak6 A C 2: 118,688,851 N17T probably damaging Het
Pcnt T A 10: 76,380,380 T2225S possibly damaging Het
Pdzd2 A G 15: 12,385,819 L955P probably damaging Het
Phf21a A G 2: 92,348,036 D357G probably damaging Het
Pih1d3 A G 1: 31,222,996 S20G probably benign Het
Pkhd1l1 G T 15: 44,558,639 A3102S probably damaging Het
Plch2 A T 4: 154,989,909 L754Q probably damaging Het
Plekhd1 A G 12: 80,721,292 N335D probably benign Het
Pole C A 5: 110,325,551 T1737N probably damaging Het
Pramel6 G A 2: 87,508,744 S96N probably damaging Het
Prdm14 A C 1: 13,125,730 Y36D possibly damaging Het
Psg27 T C 7: 18,560,417 D355G probably damaging Het
Rfc1 A T 5: 65,301,939 D225E probably damaging Het
Sec16a A G 2: 26,440,239 I588T probably damaging Het
Setd6 G A 8: 95,716,788 V60M probably damaging Het
Sgk3 A G 1: 9,891,424 I432V probably benign Het
Six2 A G 17: 85,687,505 S150P probably damaging Het
Slc1a6 T C 10: 78,800,130 V343A possibly damaging Het
Slc43a3 T C 2: 84,944,612 probably null Het
Smc3 A G 19: 53,631,533 D620G probably benign Het
Smg6 C G 11: 74,930,294 P464A probably damaging Het
Sox11 T C 12: 27,342,279 T44A possibly damaging Het
Spata22 A G 11: 73,336,226 R89G possibly damaging Het
Stk3 T C 15: 34,959,049 M256V possibly damaging Het
Syne2 A G 12: 76,015,579 D4226G possibly damaging Het
Tecpr2 T C 12: 110,968,429 S1370P possibly damaging Het
Tek A G 4: 94,827,729 I463V probably benign Het
Trib1 T A 15: 59,654,340 I253N probably damaging Het
Triobp G T 15: 78,973,895 G1232V probably damaging Het
Trpm6 G A 19: 18,876,042 V1809M probably damaging Het
Tsc22d4 A G 5: 137,762,487 K57E possibly damaging Het
Vmn2r109 T A 17: 20,564,712 K15N probably benign Het
Wdr78 G A 4: 103,050,193 T632M probably damaging Het
Wnt9a A G 11: 59,331,229 N318D probably damaging Het
Wwp1 A G 4: 19,662,181 V138A possibly damaging Het
Zfp37 A T 4: 62,191,708 M411K probably damaging Het
Zfp715 T A 7: 43,311,120 T16S probably benign Het
Zfp932 A G 5: 110,009,818 T461A possibly damaging Het
Zscan29 A T 2: 121,160,855 C817* probably null Het
Other mutations in Map2k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Map2k4 APN 11 65719479 splice site probably benign
IGL01318:Map2k4 APN 11 65756263 splice site probably benign
IGL02500:Map2k4 APN 11 65696310 missense probably damaging 1.00
IGL02628:Map2k4 APN 11 65690741 missense possibly damaging 0.83
IGL02873:Map2k4 APN 11 65719574 missense probably damaging 0.97
IGL03124:Map2k4 APN 11 65690791 missense probably damaging 0.98
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0021:Map2k4 UTSW 11 65712284 missense probably damaging 1.00
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0034:Map2k4 UTSW 11 65719611 splice site probably benign
R0646:Map2k4 UTSW 11 65712275 missense probably damaging 1.00
R2931:Map2k4 UTSW 11 65756337 missense probably damaging 0.99
R3800:Map2k4 UTSW 11 65690781 nonsense probably null
R4820:Map2k4 UTSW 11 65696375 splice site probably benign
R4913:Map2k4 UTSW 11 65709932 missense probably damaging 1.00
R5452:Map2k4 UTSW 11 65719587 missense probably damaging 0.97
R5497:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5812:Map2k4 UTSW 11 65735205 missense probably damaging 1.00
R5976:Map2k4 UTSW 11 65709952 missense probably benign 0.31
R6282:Map2k4 UTSW 11 65707016 missense possibly damaging 0.78
R6505:Map2k4 UTSW 11 65693529 missense possibly damaging 0.63
R6784:Map2k4 UTSW 11 65691751 unclassified probably benign
R7560:Map2k4 UTSW 11 65775757 missense unknown
Predicted Primers PCR Primer
(F):5'- TGCCTCTCCAAGCTGACTAG -3'
(R):5'- GCTGGATCTTTGTATTGACATCAG -3'

Sequencing Primer
(F):5'- TCTCCAAGCTGACTAGAACTTC -3'
(R):5'- GGATCTTTGTATTGACATCAGTCTTC -3'
Posted On2014-09-17